ID: 1125225502

View in Genome Browser
Species Human (GRCh38)
Location 15:37390734-37390756
Sequence CAGGAAAGACAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125225499_1125225502 -6 Left 1125225499 15:37390717-37390739 CCTTCTTCACGTGGTGGCAGGAA 0: 11
1: 270
2: 1186
3: 1922
4: 2569
Right 1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125225502 Original CRISPR CAGGAAAGACAGAATGAGGA GGG Intergenic
No off target data available for this crispr