ID: 1125228218

View in Genome Browser
Species Human (GRCh38)
Location 15:37420545-37420567
Sequence CTGTAGATCTGGCCATCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125228218_1125228221 6 Left 1125228218 15:37420545-37420567 CCTTCTGATGGCCAGATCTACAG No data
Right 1125228221 15:37420574-37420596 TGTTATTATCTTGCAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125228218 Original CRISPR CTGTAGATCTGGCCATCAGA AGG (reversed) Intergenic
No off target data available for this crispr