ID: 1125231657

View in Genome Browser
Species Human (GRCh38)
Location 15:37463517-37463539
Sequence TGGCATGGCAGGGACCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125231657_1125231668 11 Left 1125231657 15:37463517-37463539 CCCATCAGGTCCCTGCCATGCCA No data
Right 1125231668 15:37463551-37463573 TTATACTTCAAGGTGAGATTTGG No data
1125231657_1125231669 12 Left 1125231657 15:37463517-37463539 CCCATCAGGTCCCTGCCATGCCA No data
Right 1125231669 15:37463552-37463574 TATACTTCAAGGTGAGATTTGGG No data
1125231657_1125231667 1 Left 1125231657 15:37463517-37463539 CCCATCAGGTCCCTGCCATGCCA No data
Right 1125231667 15:37463541-37463563 GTGGGGGTTATTATACTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125231657 Original CRISPR TGGCATGGCAGGGACCTGAT GGG (reversed) Intergenic
No off target data available for this crispr