ID: 1125241514

View in Genome Browser
Species Human (GRCh38)
Location 15:37582251-37582273
Sequence CTCAGTGCCCAGAGTCCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125241514_1125241524 10 Left 1125241514 15:37582251-37582273 CCCTCCGGACTCTGGGCACTGAG No data
Right 1125241524 15:37582284-37582306 AGGAGGCTGAGTGGGGACTAAGG No data
1125241514_1125241521 1 Left 1125241514 15:37582251-37582273 CCCTCCGGACTCTGGGCACTGAG No data
Right 1125241521 15:37582275-37582297 AGCACTGGCAGGAGGCTGAGTGG No data
1125241514_1125241527 25 Left 1125241514 15:37582251-37582273 CCCTCCGGACTCTGGGCACTGAG No data
Right 1125241527 15:37582299-37582321 GACTAAGGGCGGCTCAGCACAGG No data
1125241514_1125241526 14 Left 1125241514 15:37582251-37582273 CCCTCCGGACTCTGGGCACTGAG No data
Right 1125241526 15:37582288-37582310 GGCTGAGTGGGGACTAAGGGCGG No data
1125241514_1125241523 3 Left 1125241514 15:37582251-37582273 CCCTCCGGACTCTGGGCACTGAG No data
Right 1125241523 15:37582277-37582299 CACTGGCAGGAGGCTGAGTGGGG No data
1125241514_1125241525 11 Left 1125241514 15:37582251-37582273 CCCTCCGGACTCTGGGCACTGAG No data
Right 1125241525 15:37582285-37582307 GGAGGCTGAGTGGGGACTAAGGG No data
1125241514_1125241522 2 Left 1125241514 15:37582251-37582273 CCCTCCGGACTCTGGGCACTGAG No data
Right 1125241522 15:37582276-37582298 GCACTGGCAGGAGGCTGAGTGGG No data
1125241514_1125241520 -7 Left 1125241514 15:37582251-37582273 CCCTCCGGACTCTGGGCACTGAG No data
Right 1125241520 15:37582267-37582289 CACTGAGGAGCACTGGCAGGAGG No data
1125241514_1125241519 -10 Left 1125241514 15:37582251-37582273 CCCTCCGGACTCTGGGCACTGAG No data
Right 1125241519 15:37582264-37582286 GGGCACTGAGGAGCACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125241514 Original CRISPR CTCAGTGCCCAGAGTCCGGA GGG (reversed) Intergenic
No off target data available for this crispr