ID: 1125242727

View in Genome Browser
Species Human (GRCh38)
Location 15:37594911-37594933
Sequence ATTCTTATCTATAGGACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125242727_1125242730 0 Left 1125242727 15:37594911-37594933 CCCTCAGTCCTATAGATAAGAAT No data
Right 1125242730 15:37594934-37594956 AATAGAACATTAGATATGAAAGG No data
1125242727_1125242731 1 Left 1125242727 15:37594911-37594933 CCCTCAGTCCTATAGATAAGAAT No data
Right 1125242731 15:37594935-37594957 ATAGAACATTAGATATGAAAGGG No data
1125242727_1125242732 20 Left 1125242727 15:37594911-37594933 CCCTCAGTCCTATAGATAAGAAT No data
Right 1125242732 15:37594954-37594976 AGGGCCTCAGAGAGCTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125242727 Original CRISPR ATTCTTATCTATAGGACTGA GGG (reversed) Intergenic
No off target data available for this crispr