ID: 1125242732

View in Genome Browser
Species Human (GRCh38)
Location 15:37594954-37594976
Sequence AGGGCCTCAGAGAGCTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125242729_1125242732 12 Left 1125242729 15:37594919-37594941 CCTATAGATAAGAATAATAGAAC No data
Right 1125242732 15:37594954-37594976 AGGGCCTCAGAGAGCTTCTAAGG No data
1125242725_1125242732 30 Left 1125242725 15:37594901-37594923 CCAGCATTTCCCCTCAGTCCTAT No data
Right 1125242732 15:37594954-37594976 AGGGCCTCAGAGAGCTTCTAAGG No data
1125242728_1125242732 19 Left 1125242728 15:37594912-37594934 CCTCAGTCCTATAGATAAGAATA No data
Right 1125242732 15:37594954-37594976 AGGGCCTCAGAGAGCTTCTAAGG No data
1125242727_1125242732 20 Left 1125242727 15:37594911-37594933 CCCTCAGTCCTATAGATAAGAAT No data
Right 1125242732 15:37594954-37594976 AGGGCCTCAGAGAGCTTCTAAGG No data
1125242726_1125242732 21 Left 1125242726 15:37594910-37594932 CCCCTCAGTCCTATAGATAAGAA No data
Right 1125242732 15:37594954-37594976 AGGGCCTCAGAGAGCTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125242732 Original CRISPR AGGGCCTCAGAGAGCTTCTA AGG Intergenic
No off target data available for this crispr