ID: 1125247415

View in Genome Browser
Species Human (GRCh38)
Location 15:37657119-37657141
Sequence GTCTTCTTCTAGGAGTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125247415_1125247418 9 Left 1125247415 15:37657119-37657141 CCATAAAACTCCTAGAAGAAGAC No data
Right 1125247418 15:37657151-37657173 AATCTTATTGACATTGACCCAGG No data
1125247415_1125247419 23 Left 1125247415 15:37657119-37657141 CCATAAAACTCCTAGAAGAAGAC No data
Right 1125247419 15:37657165-37657187 TGACCCAGGCAAAGATTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125247415 Original CRISPR GTCTTCTTCTAGGAGTTTTA TGG (reversed) Intergenic
No off target data available for this crispr