ID: 1125253392

View in Genome Browser
Species Human (GRCh38)
Location 15:37732881-37732903
Sequence CCAGAGGACATGAGAGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125253392_1125253399 -5 Left 1125253392 15:37732881-37732903 CCTCCACCTCTCATGTCCTCTGG No data
Right 1125253399 15:37732899-37732921 TCTGGTTCCCAGGATGCAGTGGG No data
1125253392_1125253403 22 Left 1125253392 15:37732881-37732903 CCTCCACCTCTCATGTCCTCTGG No data
Right 1125253403 15:37732926-37732948 AATGGAATGCGCCTCACCTCTGG No data
1125253392_1125253402 4 Left 1125253392 15:37732881-37732903 CCTCCACCTCTCATGTCCTCTGG No data
Right 1125253402 15:37732908-37732930 CAGGATGCAGTGGGCAGTAATGG No data
1125253392_1125253398 -6 Left 1125253392 15:37732881-37732903 CCTCCACCTCTCATGTCCTCTGG No data
Right 1125253398 15:37732898-37732920 CTCTGGTTCCCAGGATGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125253392 Original CRISPR CCAGAGGACATGAGAGGTGG AGG (reversed) Intergenic
No off target data available for this crispr