ID: 1125253399

View in Genome Browser
Species Human (GRCh38)
Location 15:37732899-37732921
Sequence TCTGGTTCCCAGGATGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125253392_1125253399 -5 Left 1125253392 15:37732881-37732903 CCTCCACCTCTCATGTCCTCTGG No data
Right 1125253399 15:37732899-37732921 TCTGGTTCCCAGGATGCAGTGGG No data
1125253394_1125253399 -8 Left 1125253394 15:37732884-37732906 CCACCTCTCATGTCCTCTGGTTC No data
Right 1125253399 15:37732899-37732921 TCTGGTTCCCAGGATGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125253399 Original CRISPR TCTGGTTCCCAGGATGCAGT GGG Intergenic
No off target data available for this crispr