ID: 1125253670

View in Genome Browser
Species Human (GRCh38)
Location 15:37736895-37736917
Sequence ATTCTATTCTGTAACATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125253670_1125253671 11 Left 1125253670 15:37736895-37736917 CCTGTGATGTTACAGAATAGAAT No data
Right 1125253671 15:37736929-37736951 AATTTATGACTTCAAAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125253670 Original CRISPR ATTCTATTCTGTAACATCAC AGG (reversed) Intergenic
No off target data available for this crispr