ID: 1125254195 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:37744687-37744709 |
| Sequence | CTGAGCAGTGCGGAGGAGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1125254195_1125254201 | 2 | Left | 1125254195 | 15:37744687-37744709 | CCATCCTCCTCCGCACTGCTCAG | No data | ||
| Right | 1125254201 | 15:37744712-37744734 | TCCAGCAGGTCACAACAACTGGG | No data | ||||
| 1125254195_1125254200 | 1 | Left | 1125254195 | 15:37744687-37744709 | CCATCCTCCTCCGCACTGCTCAG | No data | ||
| Right | 1125254200 | 15:37744711-37744733 | GTCCAGCAGGTCACAACAACTGG | No data | ||||
| 1125254195_1125254204 | 18 | Left | 1125254195 | 15:37744687-37744709 | CCATCCTCCTCCGCACTGCTCAG | No data | ||
| Right | 1125254204 | 15:37744728-37744750 | AACTGGGGCTTCCAGCACAGTGG | No data | ||||
| 1125254195_1125254203 | 3 | Left | 1125254195 | 15:37744687-37744709 | CCATCCTCCTCCGCACTGCTCAG | No data | ||
| Right | 1125254203 | 15:37744713-37744735 | CCAGCAGGTCACAACAACTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1125254195 | Original CRISPR | CTGAGCAGTGCGGAGGAGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||