ID: 1125254195

View in Genome Browser
Species Human (GRCh38)
Location 15:37744687-37744709
Sequence CTGAGCAGTGCGGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125254195_1125254201 2 Left 1125254195 15:37744687-37744709 CCATCCTCCTCCGCACTGCTCAG No data
Right 1125254201 15:37744712-37744734 TCCAGCAGGTCACAACAACTGGG No data
1125254195_1125254200 1 Left 1125254195 15:37744687-37744709 CCATCCTCCTCCGCACTGCTCAG No data
Right 1125254200 15:37744711-37744733 GTCCAGCAGGTCACAACAACTGG No data
1125254195_1125254204 18 Left 1125254195 15:37744687-37744709 CCATCCTCCTCCGCACTGCTCAG No data
Right 1125254204 15:37744728-37744750 AACTGGGGCTTCCAGCACAGTGG No data
1125254195_1125254203 3 Left 1125254195 15:37744687-37744709 CCATCCTCCTCCGCACTGCTCAG No data
Right 1125254203 15:37744713-37744735 CCAGCAGGTCACAACAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125254195 Original CRISPR CTGAGCAGTGCGGAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr