ID: 1125270121

View in Genome Browser
Species Human (GRCh38)
Location 15:37929551-37929573
Sequence CACAGGGAACTACATTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125270113_1125270121 22 Left 1125270113 15:37929506-37929528 CCCACCTGCAGGGCCAACTTCAT 0: 1
1: 0
2: 3
3: 22
4: 159
Right 1125270121 15:37929551-37929573 CACAGGGAACTACATTCAAAAGG 0: 1
1: 0
2: 4
3: 15
4: 176
1125270114_1125270121 21 Left 1125270114 15:37929507-37929529 CCACCTGCAGGGCCAACTTCATG 0: 1
1: 0
2: 2
3: 13
4: 211
Right 1125270121 15:37929551-37929573 CACAGGGAACTACATTCAAAAGG 0: 1
1: 0
2: 4
3: 15
4: 176
1125270118_1125270121 9 Left 1125270118 15:37929519-37929541 CCAACTTCATGGACATGGAACTT 0: 1
1: 1
2: 0
3: 14
4: 210
Right 1125270121 15:37929551-37929573 CACAGGGAACTACATTCAAAAGG 0: 1
1: 0
2: 4
3: 15
4: 176
1125270116_1125270121 18 Left 1125270116 15:37929510-37929532 CCTGCAGGGCCAACTTCATGGAC 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1125270121 15:37929551-37929573 CACAGGGAACTACATTCAAAAGG 0: 1
1: 0
2: 4
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125270121 Original CRISPR CACAGGGAACTACATTCAAA AGG Intronic
901621443 1:10591508-10591530 CACAGGGAACAAAATTCATAAGG + Intronic
904810288 1:33159181-33159203 CAGTGGTAACTACTTTCAAAGGG + Intronic
907359422 1:53902771-53902793 CACAGGGACCTACACTCAAAAGG + Intronic
909670437 1:78182439-78182461 CACAGGGACCTATACTCAGAAGG - Intergenic
910325244 1:85999247-85999269 TACAGGGAAATAAGTTCAAAGGG + Intronic
910718248 1:90256297-90256319 CAGAGGGAAGCACATTCACAGGG + Intergenic
911681697 1:100723945-100723967 CACTGGGTACCACATTTAAAGGG + Intronic
913690545 1:121275926-121275948 CAGAGAAAACTACAGTCAAAAGG + Intronic
914146996 1:145004032-145004054 CAGAGAAAACTACAGTCAAAAGG - Intronic
915730056 1:158046960-158046982 CACAGGCATCTGCATACAAAGGG - Intronic
918003136 1:180516860-180516882 AACAGGAAATAACATTCAAACGG + Intergenic
920245497 1:204584746-204584768 CACAGGGAACATTTTTCAAAGGG + Intergenic
920477864 1:206294415-206294437 CAGAGAAAACTACAGTCAAAAGG + Intronic
920526532 1:206671069-206671091 CACAGGGACCTGCATTTATAAGG + Intronic
921202220 1:212818358-212818380 CACAGGTAGCTATAGTCAAAAGG - Intergenic
924309688 1:242727265-242727287 CATCAGGAACTACAATCAAATGG + Intergenic
924867951 1:248006479-248006501 CACAGGGTCCCACACTCAAAGGG - Intronic
924872490 1:248064012-248064034 CACAAGGTCCTACACTCAAAGGG - Intronic
1064095198 10:12419025-12419047 GACAGGGAAGTTCATTCAATAGG - Intronic
1067202050 10:44181513-44181535 CACAGGGAAGGACACTCATAAGG - Intergenic
1068895443 10:62194617-62194639 CACAGGTGATTACATTCAAATGG + Exonic
1070180941 10:74013269-74013291 CACAGGGCATTGCATGCAAAAGG + Intronic
1072299229 10:94042932-94042954 CACAGAAAACTAAATTAAAATGG - Intronic
1077729638 11:4716120-4716142 CACAAGGAACTAAATTCCTACGG + Intronic
1078798010 11:14612968-14612990 GACAAGGAACTACATTAAGATGG + Intronic
1079369008 11:19834061-19834083 CACAGGTCCCTACACTCAAAGGG + Intronic
1080856346 11:36115064-36115086 CTCAGGGCACCACATTCACATGG - Intronic
1081048141 11:38302625-38302647 CACAGACAATTTCATTCAAATGG - Intergenic
1081999214 11:47383889-47383911 CACATGGTACAAAATTCAAAAGG + Intergenic
1082745033 11:56951676-56951698 CTCAGGGAACTATAATTAAAGGG + Intergenic
1083025943 11:59550800-59550822 CACAGAGAAAAACTTTCAAAAGG + Intergenic
1084516358 11:69639749-69639771 GACACTGAACTATATTCAAAAGG + Intergenic
1085876720 11:80416355-80416377 CACAGGTATTTACATTCAACAGG + Intergenic
1087622836 11:100562423-100562445 CAGAGGGAACTGCATGAAAAGGG - Intergenic
1093499660 12:19797738-19797760 CAAAGGGAGCTACATACAGATGG - Intergenic
1093845062 12:23960823-23960845 CACAGAAAACTAAATTAAAATGG + Intergenic
1095586003 12:43850104-43850126 CACAGGAAACAACATTTAATAGG + Intronic
1098378574 12:69844060-69844082 CACAGAGAACAACTCTCAAATGG - Intronic
1099141758 12:78986109-78986131 AACTAGGAAGTACATTCAAACGG + Intronic
1099981347 12:89607221-89607243 CACAGGGGGCCACATTAAAAAGG - Intronic
1100064926 12:90631659-90631681 TACAGGGAAATATTTTCAAAAGG - Intergenic
1101424320 12:104575582-104575604 CCCAGGAAACTTCCTTCAAACGG - Intronic
1102781845 12:115572239-115572261 AACAGGGAACAACACTCAAGTGG + Intergenic
1104674249 12:130702001-130702023 CACAGGGAGCAACATCCACATGG - Intronic
1105600256 13:21880294-21880316 CACGGGGTACAACATTCATACGG - Intergenic
1106737406 13:32601819-32601841 AAGAGGGAACTACATTGAATTGG + Intronic
1110251816 13:73388794-73388816 CAAAGGGAAGTACTTTCAAGAGG - Intergenic
1112112813 13:96321567-96321589 CTCAGGGAACTACAATCCACTGG + Intronic
1113545357 13:111144859-111144881 CACATGGGACAACATTCAAAGGG + Intronic
1117660905 14:58003601-58003623 GGCAGGGAATTACATTCCAAGGG + Exonic
1118020172 14:61703708-61703730 ATCAGGGAACTCCATTCACATGG - Intronic
1119783683 14:77296686-77296708 CATATGGTACTAGATTCAAAAGG - Intronic
1120053829 14:79899214-79899236 CACAGTGACCTACATTCAAGGGG - Intergenic
1124929625 15:34106580-34106602 CACATGGTACAATATTCAAAAGG + Exonic
1124929627 15:34106603-34106625 CACATGGTACAATATTCAAAAGG + Exonic
1124929629 15:34106626-34106648 CACATGGTACAATATTCAAAAGG + Exonic
1125147761 15:36492011-36492033 ACCTGTGAACTACATTCAAATGG - Intergenic
1125270121 15:37929551-37929573 CACAGGGAACTACATTCAAAAGG + Intronic
1127133562 15:55895470-55895492 AACAGGAAACTACTTTAAAATGG + Intronic
1129005915 15:72373392-72373414 CACAGGAAACTACATTCCAAAGG + Intronic
1129275926 15:74445272-74445294 CACAGGGAACGCCATGCCAAGGG + Intergenic
1131798658 15:96046842-96046864 CACAAGGAAATACCTCCAAAAGG + Intergenic
1135607000 16:23834090-23834112 TCCAGGGCACTTCATTCAAAAGG + Intergenic
1137749867 16:50852780-50852802 CACAGAAAACCAAATTCAAAAGG - Intergenic
1143864024 17:9911122-9911144 CCCAGGGACAGACATTCAAAGGG - Intronic
1143943308 17:10566036-10566058 CACAGGGTTCCACACTCAAAGGG + Intergenic
1144848007 17:18230078-18230100 CACAGGGAACTACAGGCAGGTGG - Intronic
1147130833 17:38407754-38407776 AAAAGGGAAATACATTCATAAGG - Intergenic
1149629560 17:58111165-58111187 CACAGGTAAATAAATACAAATGG + Intergenic
1149854848 17:60073087-60073109 CACAGGGAACTACCTACAAAGGG + Intronic
1153142729 18:1993417-1993439 CACAAAGAACTCCCTTCAAATGG + Intergenic
1156093931 18:33506673-33506695 CAAAAGGGATTACATTCAAAAGG - Intergenic
1156215934 18:34998134-34998156 CAAAGGAATCTACTTTCAAAAGG - Intronic
1157314542 18:46576636-46576658 TACAAGGAATTACATTGAAAAGG - Intronic
1163739647 19:19003612-19003634 CACAGTCAACAAAATTCAAATGG + Intronic
1165716948 19:38052539-38052561 CACAGGGAACTACATTTCCCAGG - Intronic
1167650848 19:50727819-50727841 CACAAGCATCTTCATTCAAAGGG - Intergenic
925085436 2:1104110-1104132 CACAGGGACAGACATGCAAATGG + Intronic
926746378 2:16161796-16161818 CACGGGGAACTACAGACAGATGG - Intergenic
926936968 2:18095718-18095740 CCCATGGAAATACATTAAAAGGG + Intronic
929458984 2:42087424-42087446 CAAAGGGGTCTACATTCCAATGG + Intergenic
930191268 2:48462696-48462718 GACTGGGAACTTCATTCATAAGG + Intronic
932943403 2:76196824-76196846 CACAGAGCACTGCATACAAATGG - Intergenic
935648856 2:105364999-105365021 CACAGGCTACTGCATTCACATGG - Intronic
936039557 2:109139873-109139895 GACAGGGGTCTACATCCAAAAGG + Intronic
938752022 2:134341539-134341561 CACACTGAACCACATACAAAAGG - Intronic
938846009 2:135209964-135209986 CACATGGTTCTAAATTCAAAAGG + Intronic
939993441 2:148898087-148898109 CACAGTGATCTACATGCAGAAGG - Intronic
940051891 2:149473709-149473731 CACAGGGAACTTCCTTCCAGAGG + Exonic
940487130 2:154309991-154310013 CACGTGGAACTACATTCATTGGG + Intronic
941285489 2:163607748-163607770 CCCAGGAAAATACATTCAAAAGG + Exonic
941695982 2:168551140-168551162 CACAGGGACCCCCATTCAGAAGG - Intronic
943651367 2:190461296-190461318 CACTTGGAAAAACATTCAAAAGG + Intronic
943795015 2:191981304-191981326 CATAGGGAACAACATTTAAAAGG - Intronic
945181009 2:207091109-207091131 CACAGGCAACCACATTCTGAAGG + Intronic
946505279 2:220293755-220293777 CACAGGAAGCTACATAAAAAAGG - Intergenic
948882638 2:240868253-240868275 GACAGGGAACCCCATTCAGATGG + Intergenic
1169217644 20:3802720-3802742 CCCAGGGAACAACCTTCCAAGGG - Intronic
1170823323 20:19772482-19772504 CACAGGGCCCTGCATTCAGAAGG - Intergenic
1171004041 20:21445575-21445597 CACAGAGAACTATCTACAAAAGG - Intergenic
1172301182 20:33851558-33851580 CACAGTGAAATACCTTCAACAGG - Intronic
1173378412 20:42511945-42511967 AACAAGGAACAACATTCCAAAGG + Intronic
1173391632 20:42640343-42640365 CACTGGGAACTTCATTCACTGGG + Intronic
1177918050 21:27115473-27115495 CTCAGGGAACTTAATTCACATGG - Intergenic
1178320682 21:31602859-31602881 CACAGGGCCCCACATTCAGAAGG + Intergenic
1179026848 21:37686109-37686131 CACAGGATAAGACATTCAAATGG - Intronic
950699148 3:14728075-14728097 CACAGGGAACAGCATTCTCAAGG + Intronic
950786617 3:15441734-15441756 CACAGGAATGGACATTCAAATGG + Exonic
953592231 3:44269446-44269468 GATAGGGAAATACAATCAAAAGG - Intronic
955666568 3:61355582-61355604 TACAGGGAACTAGTTACAAAAGG + Intergenic
955897955 3:63720864-63720886 CACAGGGAACTGGAGTCAGAAGG + Intergenic
956460844 3:69470720-69470742 CAAAGAGAACTACATTCCTAGGG + Intronic
956657204 3:71564005-71564027 CTGAGGGAACCTCATTCAAATGG - Intronic
957873311 3:86114311-86114333 CTCAGGGAACTACTTTCACAGGG - Intergenic
959913962 3:111795381-111795403 CAGAAGCAACTGCATTCAAATGG - Intronic
961046235 3:123710188-123710210 CACATGGCACAAAATTCAAAAGG + Intronic
962256120 3:133871387-133871409 CACAGGGAACAACATTCCCGGGG + Intronic
962748420 3:138415003-138415025 AAAAGGAAACTACATTCTAAGGG - Intergenic
962852167 3:139316279-139316301 CCCATGGAGCTACATTCTAATGG + Intronic
962968106 3:140372620-140372642 CACAGGCAACTCCATTAACATGG + Intronic
964702588 3:159585434-159585456 CACATGGAACAACATGAAAATGG - Intronic
965065670 3:163844929-163844951 CACAGGGAAATAAAGTTAAAAGG - Intergenic
967399659 3:189046521-189046543 AACAGGGAAATACAGTGAAAGGG + Intronic
968929026 4:3566282-3566304 CACAGGGAACCAGAGGCAAAGGG - Intergenic
972347222 4:38202626-38202648 CATTGTGAAATACATTCAAAAGG - Intergenic
972746650 4:41939775-41939797 CCCAGTGAACTAGATACAAATGG + Intronic
975956559 4:79847591-79847613 CTCAGGCAACAACATTCATATGG + Intergenic
978913664 4:114096812-114096834 TAAAAGGAACTACATTAAAATGG - Intergenic
981596945 4:146435268-146435290 CACAGGGACCAACAATTAAAGGG + Intronic
982198979 4:152941661-152941683 TACACAGAACTACATCCAAAAGG - Intronic
982508306 4:156248594-156248616 CATAGTGAACTATATCCAAAAGG + Intergenic
982586256 4:157244139-157244161 TAGAGGGAACTAAATACAAAGGG + Intronic
983779184 4:171646180-171646202 AACATGGAGCTAAATTCAAAGGG - Intergenic
986662002 5:10067525-10067547 CCCAGGGTACTATGTTCAAAAGG + Intergenic
987522106 5:19000145-19000167 GAAAGGCAACTCCATTCAAATGG + Intergenic
987638182 5:20574417-20574439 CTCAGGGAACTTCACTCAAAAGG + Intronic
987869012 5:23588211-23588233 CGTAGGAAAGTACATTCAAATGG + Intergenic
995086047 5:108110536-108110558 AATAGGAAACTACTTTCAAATGG - Intronic
996290061 5:121842302-121842324 CACAGGGACCTTCACTCAGAGGG - Intergenic
997234149 5:132263098-132263120 CACAAGAAACTACTTTGAAATGG - Intronic
998062150 5:139127159-139127181 AACAGGGAGCTACAGACAAAAGG + Intronic
998569776 5:143246714-143246736 CACAGGGTACGAAACTCAAAAGG + Intergenic
999070148 5:148736040-148736062 CACAGGGACCCACACTCAGAGGG - Intergenic
999181833 5:149675221-149675243 CACATGGTACAAAATTCAAAAGG - Intergenic
999813445 5:155151158-155151180 CACATGGATCAACATTTAAAAGG + Intergenic
1000753827 5:165131932-165131954 TACAGAGAACTATATCCAAATGG - Intergenic
1001241396 5:170073977-170073999 AACAGCGAACTAAATTCAAAGGG - Intronic
1007640717 6:43337387-43337409 TCCAGGGAACTACATTTAGAAGG + Exonic
1008456390 6:51715895-51715917 GACAGGGAAGGAAATTCAAATGG + Intronic
1008552532 6:52646800-52646822 GACAGGGCACTACACTCAGAAGG + Intergenic
1008680811 6:53869961-53869983 TACAGGCAAATACATTCAAAGGG + Intronic
1009839020 6:69042784-69042806 CAGAGGGAACAACTTACAAATGG - Intronic
1011033632 6:82949984-82950006 CACAGGCAACTAAAGTAAAATGG + Intronic
1011739072 6:90341444-90341466 CACTGGAAACTTAATTCAAAAGG + Intergenic
1011770112 6:90666260-90666282 CACAGTGAACTAGTTTCCAATGG + Intergenic
1012798809 6:103799029-103799051 TTTAGGGACCTACATTCAAAAGG - Intergenic
1013691314 6:112648224-112648246 CTCATGGAACTACATTCTAGTGG + Intergenic
1014365777 6:120539904-120539926 CACAGGGCCCTACATCAAAAAGG - Intergenic
1014462746 6:121717195-121717217 CACAGGATTCTACATTCTAATGG - Intergenic
1014586700 6:123206152-123206174 AACAGGGAACCTCAATCAAATGG - Intergenic
1014723382 6:124946841-124946863 CACAGGAAAATAAAGTCAAAAGG + Intergenic
1017208789 6:151832531-151832553 CACAGGTAACCACATTTAGATGG + Intronic
1019485306 7:1286437-1286459 TTCTGGGAACCACATTCAAAAGG + Intergenic
1020379774 7:7530621-7530643 CACACGGCACCACAATCAAAAGG - Intronic
1023387173 7:39670536-39670558 CACATGGATCAAAATTCAAAAGG + Intronic
1025119763 7:56291424-56291446 CACAGGGAAATCCAGTCAATAGG - Intergenic
1028109218 7:86918818-86918840 CACGGGGAACTAAAATGAAATGG + Intronic
1030394955 7:108974413-108974435 CATAGGGCACCACACTCAAAAGG - Intergenic
1031820213 7:126491384-126491406 TACAGGGAACTACAATGAAATGG + Intronic
1032428388 7:131840474-131840496 CACAGGGAACAAGAGTCAAATGG + Intergenic
1032694941 7:134327108-134327130 CAAAGGGTACAAAATTCAAAAGG + Intergenic
1033915651 7:146322054-146322076 CACATGGAAATAAATTCATAGGG + Intronic
1036237917 8:7057469-7057491 CACAAGGAACAACATTCAAAAGG + Intergenic
1037288232 8:17323454-17323476 AACAGGGAACTCCAAGCAAATGG + Intronic
1037788464 8:21917130-21917152 CACAGGGGACAACTTTCAAGAGG + Intergenic
1038264556 8:26028223-26028245 CACAATGACCTTCATTCAAAAGG - Intronic
1039064182 8:33595039-33595061 TACAAGGAAGTACATTCTAATGG + Intronic
1041256508 8:55983595-55983617 CTCAGGACACTACATCCAAAGGG + Intronic
1042611337 8:70604761-70604783 CAAAAGGAAATATATTCAAAAGG - Intronic
1042860937 8:73313447-73313469 AAAAGGGAAGGACATTCAAATGG - Intronic
1043626491 8:82267139-82267161 CACAGGGTCCCACATTCAGAAGG - Intergenic
1045408396 8:101891040-101891062 AACAGCCAACTACATACAAATGG + Intronic
1046834489 8:118784532-118784554 CACAGGTAACTACATTATATAGG + Intergenic
1047438366 8:124854740-124854762 CACAGTGATCCACACTCAAAGGG + Intergenic
1047524921 8:125624824-125624846 CACAGAGAACTGAATTCAAAAGG - Intergenic
1048964532 8:139606024-139606046 CATAGAGAACCAAATTCAAAAGG - Intronic
1053165015 9:35838188-35838210 CACCTGGTACAACATTCAAAAGG + Intronic
1055346359 9:75343848-75343870 TACATGGAACTACATGGAAACGG - Intergenic
1057877011 9:98765375-98765397 CACACAGAACTACATACAGAGGG - Intronic
1058080797 9:100699218-100699240 CACAGGGCACTAGAATCATATGG + Intergenic
1185433314 X:22109-22131 CACAGGAAACAACAGTGAAAAGG + Intergenic
1188823992 X:34807736-34807758 AACAGGGAACGACATGCAAATGG + Intergenic
1189343053 X:40219143-40219165 CACAGGGCACCACACTCAAAAGG - Intergenic
1195136896 X:101917157-101917179 CACAGGCAACAACATAAAAACGG + Intronic
1195269099 X:103213424-103213446 TACAAGAAACTACATTCATAAGG + Intergenic
1198480005 X:137032570-137032592 CACAGCGAACGACATTGAACAGG - Intergenic