ID: 1125270154

View in Genome Browser
Species Human (GRCh38)
Location 15:37929826-37929848
Sequence AGGTTGCCCAACCAGTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125270154 Original CRISPR AGGTTGCCCAACCAGTATCT TGG (reversed) Intronic
907374846 1:54028094-54028116 ACGTTTGCCAACCAGTCTCTAGG - Intergenic
910503529 1:87923180-87923202 AAGTTGACAAACTAGTATCTAGG + Intergenic
912456969 1:109804426-109804448 AGGTTGCTCTTCCTGTATCTAGG + Intergenic
917901450 1:179547002-179547024 ATGTTTCCCAAGTAGTATCTGGG - Intronic
1070550292 10:77485850-77485872 AGGGTGACCAACCAGTATTGTGG + Intronic
1081997458 11:47374722-47374744 AGGTTGCCCAAAGTGGATCTTGG - Intronic
1082219944 11:49622633-49622655 ATGTTTTCCAAACAGTATCTAGG - Intergenic
1086629676 11:89002158-89002180 ATGTTTTCCAAACAGTATCTAGG + Intronic
1088590707 11:111400127-111400149 AGGTTGCCCAGCCAGTCAGTGGG - Intronic
1090029015 11:123192170-123192192 AGGTTCCCTACCGAGTATCTGGG + Intronic
1090650508 11:128802010-128802032 AGGCTGCCCAACATGTTTCTGGG + Intronic
1111102501 13:83606253-83606275 TGGTAGCCCAAGCAATATCTGGG - Intergenic
1111717290 13:91895441-91895463 AGGTTGGACAAGCAGTCTCTGGG + Intronic
1113751892 13:112782312-112782334 AGCTTTCCAAACCAGTGTCTGGG + Intronic
1119422216 14:74514117-74514139 AGGCTGTCCCACCAGCATCTTGG + Intronic
1121291000 14:92775144-92775166 AGGTCACCCAGCCAGTCTCTGGG + Intergenic
1125270154 15:37929826-37929848 AGGTTGCCCAACCAGTATCTTGG - Intronic
1145357867 17:22179610-22179632 AGGTTGCACAATCAGTGTCAAGG + Intergenic
1149545681 17:57501977-57501999 AGGTTGCATAGCCAGTTTCTAGG + Intronic
1156184194 18:34642278-34642300 AGGTTGCCCAACTGGAAGCTGGG + Intronic
1156853797 18:41758206-41758228 AGTTTTCCCAAACAGGATCTGGG + Intergenic
1157621398 18:49019158-49019180 AGGTTGGGGAACCAGTCTCTAGG + Intergenic
1166597003 19:44058991-44059013 ACATTGCCCACCCTGTATCTGGG + Intronic
929670751 2:43875197-43875219 AGGTTGGCCAGCCAGTAGGTGGG - Exonic
931132675 2:59355008-59355030 AGGTTCTCCATCCAGAATCTGGG - Intergenic
936254518 2:110900471-110900493 AGGTTCCTCAACCATTAACTGGG - Intronic
937934577 2:127232543-127232565 AGGTAGGCCAACCACTGTCTTGG + Intergenic
940114170 2:150189954-150189976 ATGTTTCCCAACCAGTAGCTTGG + Intergenic
941997767 2:171616825-171616847 AGGTTGCCCAACCCCTCTCTAGG - Intergenic
943111318 2:183609716-183609738 AGATTTCCTAACCAGTATCCAGG - Intergenic
948422369 2:237867843-237867865 AGGGTCCACAACCTGTATCTTGG - Intronic
948805434 2:240451884-240451906 GGGTTCCCCAAGCAGGATCTGGG + Intronic
1169746536 20:8948879-8948901 ATGTTGCCCAAGGAATATCTTGG - Intronic
1170009307 20:11704139-11704161 AGGTTTCCCATTCTGTATCTTGG - Intergenic
1170013086 20:11749373-11749395 TGGCTACCCAACCAGTATTTGGG - Intergenic
1178215200 21:30588918-30588940 AACTTGCCCAACCAGTGACTGGG - Intergenic
1183458284 22:37934468-37934490 AGGTGGCCCAACCTGGTTCTGGG - Intronic
950305817 3:11914849-11914871 AGGTTGCCCGGCCTGTACCTAGG - Intergenic
952233814 3:31458463-31458485 AGCCTCCCCAGCCAGTATCTGGG - Intergenic
954653982 3:52182685-52182707 AGGTTGCCCCACCAACATCTGGG + Intergenic
955402600 3:58603901-58603923 AGGCTCCCCAACTAGTAACTGGG + Intronic
960133154 3:114078842-114078864 AGGATGCTCAACCTGTACCTTGG + Intronic
961713524 3:128844483-128844505 AGGTTGCCCGGCCTGTACCTAGG + Intergenic
971487055 4:27171249-27171271 AGGATGGCCAACCAATAACTCGG - Intergenic
971989873 4:33878775-33878797 AGATTGCCATACCAGCATCTGGG - Intergenic
972944647 4:44239345-44239367 AGGTTGCACAGCCAGTAAGTGGG - Intronic
973995164 4:56451223-56451245 AGGTTTCCCCAACAGGATCTGGG - Intronic
975065496 4:70057834-70057856 AAGTTGCACAACCACCATCTGGG + Intronic
980257322 4:130398966-130398988 ATGTTGCCCATTCAGTATGTTGG + Intergenic
981335349 4:143562966-143562988 CAGTTGCCCAAGCAGTATCTGGG - Intergenic
985333554 4:188867963-188867985 AGGTTGCACAACTGGTATGTAGG - Intergenic
985980390 5:3457595-3457617 AGTTTGCCCACCAAATATCTTGG - Intergenic
986824722 5:11507887-11507909 AGGTTTCCCACCGAGTATTTTGG - Intronic
992522997 5:77575644-77575666 AGGTTGCACAATTAGTATCACGG - Intronic
994345565 5:98681567-98681589 TGGTTGCCCAAGGACTATCTGGG + Intergenic
999077375 5:148809113-148809135 AGCTTGCTCAAGCAGTTTCTGGG - Intergenic
999377528 5:151097163-151097185 GGGTTGCCCAACCTGAATTTCGG - Intergenic
1001296382 5:170502089-170502111 AAGTTGCCCAGCCAGGATGTGGG - Intronic
1001454346 5:171849176-171849198 AGGTTGCCCAGCCAGCAGATGGG - Intergenic
1002838391 6:884817-884839 AGGTTGACCAACCACTATGTGGG - Intergenic
1009846316 6:69139734-69139756 AGCTTACCCAACCAGTAAGTGGG + Intronic
1012606599 6:101165943-101165965 AGGTTACCCAACCAGTAAGTGGG + Intergenic
1016461481 6:144284403-144284425 AGGTTGACCAAAAAATATCTGGG - Intergenic
1016640383 6:146341552-146341574 ATGTTGCCCAATTAGTATTTTGG + Intronic
1021570699 7:22062250-22062272 TGGTTTCTCAGCCAGTATCTAGG + Intergenic
1026994623 7:74607194-74607216 AGGTTGCATAAACAGCATCTGGG - Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1036807612 8:11846272-11846294 GGGCTGCCCAACCAGGCTCTCGG + Intronic
1048536511 8:135301171-135301193 AGGGTCCCCAACCAGTAAGTGGG - Intergenic
1050597984 9:7223326-7223348 AGGTTCTCAAACCTGTATCTAGG + Intergenic
1051152580 9:14099781-14099803 ACCATGCCCAGCCAGTATCTTGG - Intronic
1192833348 X:74773527-74773549 AGGTTGCCCTACCAGTCTTGGGG - Intronic
1195169273 X:102249965-102249987 ATATTTACCAACCAGTATCTCGG + Intergenic
1195189584 X:102437123-102437145 ATATTTACCAACCAGTATCTCGG - Intronic
1195919823 X:109972467-109972489 ATGTTGCCAAAGCAGTATCAAGG - Intergenic