ID: 1125270534

View in Genome Browser
Species Human (GRCh38)
Location 15:37934100-37934122
Sequence CGCGCGCGCGTGTGTGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 2, 2: 9, 3: 41, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125270534 Original CRISPR CGCGCGCGCGTGTGTGTAGG GGG (reversed) Intronic