ID: 1125270746

View in Genome Browser
Species Human (GRCh38)
Location 15:37936075-37936097
Sequence TGTTAGATTGAGCACTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125270744_1125270746 -6 Left 1125270744 15:37936058-37936080 CCAGAGTGAAGGTGCACTGTTAG 0: 1
1: 0
2: 0
3: 15
4: 86
Right 1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG 0: 1
1: 0
2: 1
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125270746 Original CRISPR TGTTAGATTGAGCACTTTGG AGG Intronic
903741720 1:25562365-25562387 AGTGAGAGTGAGAACTTTGGTGG + Intronic
907754061 1:57292778-57292800 TGTTAGACTGAGCTTCTTGGAGG - Intronic
907784112 1:57595355-57595377 GGTTAGATTGAGAGATTTGGGGG - Intronic
907966256 1:59332684-59332706 TGTAATATTGAGCACTCTGTAGG + Intronic
911292275 1:96071544-96071566 AGTTAGATTCAGAACTTGGGAGG + Intergenic
912175299 1:107148370-107148392 AGGTATATTGAGGACTTTGGTGG - Exonic
923090361 1:230735836-230735858 TGATAGACTGAGCAGTTGGGGGG - Intergenic
923343450 1:233027216-233027238 TGTTAGATTTGGCAATATGGAGG + Intronic
924043264 1:240004467-240004489 TGTAAGATTCAGTGCTTTGGGGG + Intergenic
924543874 1:245007028-245007050 TGTTAGAATGAGAAATTTGGAGG + Intronic
1062995775 10:1865184-1865206 TGAGGGATTGAACACTTTGGTGG + Intergenic
1065887219 10:30089124-30089146 TGATGGATTGAGCACTGTGCTGG + Intronic
1068444914 10:57108538-57108560 TGTTAAATTGATATCTTTGGGGG - Intergenic
1073398578 10:103238656-103238678 TGCTAGATTGTGCAATTAGGAGG + Intergenic
1080029592 11:27646827-27646849 TGTTAGATTGAGCTTTCTGGTGG + Intergenic
1081139647 11:39483040-39483062 TGTAAGACTGAGCACTGTGCTGG - Intergenic
1082601564 11:55163733-55163755 CTTTTGATTGAGCAGTTTGGAGG - Intergenic
1087530261 11:99372755-99372777 TGTTTGATTGAGGATTTTGTAGG - Intronic
1091986445 12:4913011-4913033 TGTTGCATTGAGGATTTTGGGGG + Exonic
1095079143 12:37975969-37975991 TTTTTTATTGAGCAGTTTGGAGG + Intergenic
1099876462 12:88412823-88412845 TGTTCTAATGAGCACTGTGGAGG - Intergenic
1102135033 12:110567142-110567164 TGTGAGACTCAGCCCTTTGGAGG - Intronic
1102227675 12:111240429-111240451 TGTTAGCTTGAGTGCTGTGGGGG - Intronic
1104286548 12:127429862-127429884 TTTTACACTGAGCACTTTGGTGG - Intergenic
1105410764 13:20169413-20169435 TGTTAGATAAAACCCTTTGGAGG + Intergenic
1106269643 13:28139879-28139901 TGTGCGACTGAGCACTTGGGTGG + Intronic
1107020682 13:35747762-35747784 TGTTGGATTTGGCAATTTGGAGG - Intergenic
1108340225 13:49492220-49492242 TGTGAAATTTAGCTCTTTGGGGG - Exonic
1109029580 13:57175989-57176011 TGTTTAATTAAGCATTTTGGTGG - Intergenic
1112958731 13:105094384-105094406 TGTTAGATAGGGAACATTGGAGG - Intergenic
1113264579 13:108603676-108603698 TGCTATATTTAGCAGTTTGGTGG + Intronic
1115625920 14:35191773-35191795 TTTTGGTTTGAGCAATTTGGTGG - Intronic
1116609187 14:47045609-47045631 TATTAGATTGAGAATGTTGGAGG + Intronic
1116736991 14:48703852-48703874 TATTAGAATCAGCACTTTAGAGG - Intergenic
1120017341 14:79488822-79488844 TTTTAGAATGATCTCTTTGGGGG + Intronic
1122482531 14:102056290-102056312 TGATTGATTGAGCAGTCTGGGGG - Intergenic
1125265763 15:37878860-37878882 TGGCAGATTGATCATTTTGGGGG - Intergenic
1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG + Intronic
1126044072 15:44621808-44621830 TGTTAAATTGGGCTCTGTGGTGG - Exonic
1126447913 15:48770596-48770618 TATTAGTTTAAGCATTTTGGTGG - Intronic
1128851566 15:70963007-70963029 TGTTAATTCCAGCACTTTGGGGG + Intronic
1131470708 15:92694197-92694219 TGCTACATTGAGCCCTCTGGTGG - Intronic
1134154592 16:11832484-11832506 ACTTAGATTGTGCATTTTGGGGG - Intergenic
1135740608 16:24972113-24972135 TATCAGATGGAGCCCTTTGGAGG - Intronic
1136019384 16:27430302-27430324 TGTTTCATGGAGCCCTTTGGTGG - Intronic
1136543584 16:30942758-30942780 TGTGAGACTCAGCAGTTTGGTGG + Intronic
1136932998 16:34435698-34435720 TCTTATATTGGGCAGTTTGGGGG - Intergenic
1136971574 16:34976116-34976138 TCTTATATTGGGCAGTTTGGGGG + Intergenic
1138360328 16:56422810-56422832 TGTTATTTTGGGCACTTTGGAGG - Intronic
1139217243 16:65138709-65138731 TGTTTGACTGAGTACTTTGCTGG + Intergenic
1142628762 17:1209801-1209823 TTTTTCATTGAGCAGTTTGGAGG + Intronic
1143360862 17:6369626-6369648 TGATTGATAGATCACTTTGGGGG - Intergenic
1143825498 17:9603035-9603057 TGTTACATGGAGCTCTTTGGAGG - Intronic
1146635496 17:34501365-34501387 TGTTGGATTCAGCACTCAGGTGG - Intergenic
1147813905 17:43194501-43194523 TGGAAGATTCAGCACTTTGAAGG + Intronic
1148658958 17:49312079-49312101 TTTTAGTTTGAGCTTTTTGGTGG - Intronic
1151073651 17:71246674-71246696 TTTAAGGTTGAGCACTTTTGAGG - Intergenic
1159747065 18:72250172-72250194 TGTTTGTTTGATTACTTTGGAGG - Intergenic
926214761 2:10898088-10898110 TGTGAGACAGAGCTCTTTGGGGG - Intergenic
927575555 2:24199275-24199297 TGATGGGGTGAGCACTTTGGCGG + Intronic
929019018 2:37531917-37531939 AGTTAGAATAAGTACTTTGGGGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
935821487 2:106897230-106897252 TCTTAGATTGGGCACCTAGGTGG - Intergenic
938890765 2:135702949-135702971 TGTTAGAGACAGCACTTTAGTGG - Intronic
939440930 2:142248445-142248467 TGGAAGATTTAGCAGTTTGGGGG - Intergenic
945944355 2:215980608-215980630 TTTTTTATTGAGCAATTTGGAGG + Intronic
945965643 2:216183687-216183709 TGTTAGATTGAGGAAGTTTGGGG + Intronic
947120868 2:226813387-226813409 TGTTAGATAGATCACTCTTGTGG + Intergenic
947795308 2:232890613-232890635 TTTTACCTTGAGCAGTTTGGGGG - Intronic
1168957985 20:1848156-1848178 TGTGAGATGGAGGCCTTTGGAGG + Intergenic
1171445712 20:25203074-25203096 TGTTTGTTTTAGCAGTTTGGGGG + Intronic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1175513472 20:59551752-59551774 TGATCGATTGAGCAAGTTGGGGG + Intergenic
1177023875 21:15896892-15896914 TTGTAGATGTAGCACTTTGGTGG - Intergenic
1184628629 22:45757506-45757528 TGTTTCATTCAGTACTTTGGAGG + Intronic
949980050 3:9496775-9496797 TTTTAGAAAGAGCACTCTGGTGG - Intergenic
955072786 3:55585629-55585651 TGTTAGAGAGAGCTCTTTGGGGG + Intronic
956419681 3:69073961-69073983 TGTTAGAATGAGCCTTTAGGGGG + Intronic
958552231 3:95630886-95630908 TGTTAGATTGCTCGCTCTGGGGG + Intergenic
959237865 3:103747716-103747738 TGTTAAATTGTACATTTTGGAGG - Intergenic
964929083 3:161993793-161993815 TTTTGGATTGAGCACAGTGGTGG + Intergenic
966275357 3:178159444-178159466 TGTTTGATTGAGTAATTTTGGGG - Intergenic
969039234 4:4282080-4282102 TTTTATATTGACGACTTTGGAGG - Intronic
969878135 4:10151055-10151077 TGTTTGAATTAGCACCTTGGAGG + Intergenic
972176776 4:36417795-36417817 TGTTAGAATGAACAATTTGAGGG + Intergenic
973020317 4:45197363-45197385 TGTTTGATTGTGCACATTTGGGG - Intergenic
973186843 4:47339963-47339985 AGTTATAGTTAGCACTTTGGAGG - Intronic
974327388 4:60431847-60431869 TATTGGATTTAGCAATTTGGAGG - Intergenic
975264464 4:72345688-72345710 TGTTAGAATTAGAACTTTTGGGG - Intronic
975300664 4:72787026-72787048 TGTGAGAGTGAGCGATTTGGAGG - Intergenic
978147918 4:105398653-105398675 TGGTAGAATGAACACTTAGGAGG + Intronic
978351005 4:107820660-107820682 TTTTGGTTTGAGCTCTTTGGTGG - Intergenic
983288230 4:165766781-165766803 TATTATTTTGAGCACGTTGGGGG + Intergenic
983701628 4:170603032-170603054 TATTAGATTGAGCTCCTTGAAGG - Intergenic
984497350 4:180515461-180515483 TGATAGATTGGGCACTGTGCTGG + Intergenic
984611145 4:181839648-181839670 TTTTAGATCGAGAAGTTTGGGGG + Intergenic
984773240 4:183456635-183456657 TGATAGATTAAGTATTTTGGAGG - Intergenic
987529271 5:19096069-19096091 TGTTTGATTTACTACTTTGGTGG - Intergenic
988315422 5:29620475-29620497 TTTTATATAGAGAACTTTGGTGG + Intergenic
988499543 5:31772994-31773016 TGTGAGACAGAGGACTTTGGAGG + Intronic
988868375 5:35360617-35360639 TGTTTGATAGTTCACTTTGGAGG - Intergenic
994103591 5:95921031-95921053 TTTTAGATTGAGCAATTCAGTGG - Intronic
994430978 5:99660990-99661012 TGTTAGCTTGAGCGCTTGGATGG + Intergenic
995401218 5:111744141-111744163 TTTTGGAATGAGCACTTCGGGGG - Intronic
998280790 5:140805391-140805413 TGTTTGATTCAGAAATTTGGTGG + Intronic
999676769 5:154012029-154012051 TTTTAGAAAGATCACTTTGGTGG + Intronic
1001225051 5:169936994-169937016 TGGTAGCTTGAACACTGTGGAGG + Intronic
1001646783 5:173288053-173288075 TGTAACTTTGGGCACTTTGGGGG - Intergenic
1002284327 5:178152244-178152266 TTTTATACTCAGCACTTTGGAGG - Intronic
1007192195 6:40028939-40028961 AGTTAGAAAAAGCACTTTGGGGG + Intergenic
1008828790 6:55732626-55732648 AGTTAGATTGGGCATTTTGTCGG - Intergenic
1011248494 6:85344986-85345008 AGTTAGAGTTAGTACTTTGGTGG - Intergenic
1015825817 6:137310374-137310396 TGCTAGTTTGGCCACTTTGGGGG + Intergenic
1017856738 6:158356436-158356458 TATTGGATTCAGCAGTTTGGAGG + Intronic
1018130855 6:160731451-160731473 GGTTAAGTTGAGCACCTTGGAGG - Intronic
1022999252 7:35790755-35790777 TGGTAGATTAAGCACTATAGGGG + Intergenic
1023226193 7:37971523-37971545 TGTTATATTGAGGAATTTGAAGG + Intronic
1023385219 7:39649938-39649960 TGTTGGATTTAGCAGTGTGGAGG + Intronic
1025518197 7:61682631-61682653 CCTTTGATTGAGCAGTTTGGAGG - Intergenic
1025542523 7:62111279-62111301 CCTTTGATTGAGCAGTTTGGAGG - Intergenic
1025550641 7:62243436-62243458 CTTTTGATTGAGCAGTTTGGAGG + Intergenic
1026439951 7:70435467-70435489 TGTGTGATTGAGCACCTTGCTGG + Intronic
1026809699 7:73452900-73452922 TGTTTGATTGTTTACTTTGGTGG - Intronic
1027739767 7:81986189-81986211 AGTTAGATTGGGCATTTTAGAGG - Intronic
1030591897 7:111492172-111492194 TTTGAGATCGAGCACTTTGCAGG + Intronic
1031771908 7:125854345-125854367 TGTTAGATTAATCACTTACGTGG - Intergenic
1032712000 7:134468748-134468770 TGTTCCATTGTGCACTTAGGTGG - Intergenic
1033904174 7:146181136-146181158 AGTTACTTTAAGCACTTTGGGGG + Intronic
1035961147 8:4139686-4139708 TGTTAGAATGATGATTTTGGTGG + Intronic
1043789841 8:84450825-84450847 TGTTATATTGAGTAATTTGATGG - Intronic
1044303019 8:90607330-90607352 TGTAAGCATGAGCAATTTGGAGG - Intergenic
1046383996 8:113485857-113485879 TTGTAGATTTAGCACCTTGGTGG + Intergenic
1051933663 9:22417153-22417175 TCTTATATTGATTACTTTGGTGG + Intergenic
1052379006 9:27749972-27749994 TGCAAGATTGAGAACTGTGGTGG + Intergenic
1055742579 9:79406301-79406323 TGTTTCAATGACCACTTTGGGGG - Intergenic
1056101425 9:83303739-83303761 TTTTAGATTGTACACTTTGGTGG + Intronic
1188024597 X:25195123-25195145 GGTTGGATTGAGCACATTGCCGG + Intergenic
1189455451 X:41184103-41184125 TGTTAGATATAGCACTTGTGAGG - Exonic
1189745718 X:44166974-44166996 TTTTAGAAAGAGCACTGTGGTGG - Intronic
1194985118 X:100481774-100481796 TGTTAGATATATGACTTTGGAGG - Intergenic
1196637277 X:118017077-118017099 TGCTAGAAAGATCACTTTGGTGG - Intronic
1197752634 X:129976028-129976050 TGTTTGATTAAGAACTTTGTTGG + Intergenic
1198185859 X:134253720-134253742 TTTTATTTTTAGCACTTTGGGGG - Intergenic
1199525401 X:148785973-148785995 TGTTACATTGGGCACCTTGCTGG - Intronic
1199637187 X:149825257-149825279 TGTTGGGTTGAGTGCTTTGGCGG - Intergenic