ID: 1125271563

View in Genome Browser
Species Human (GRCh38)
Location 15:37944435-37944457
Sequence ACTAGGTCATTGAACCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125271563_1125271566 3 Left 1125271563 15:37944435-37944457 CCATGATGGTTCAATGACCTAGT 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1125271566 15:37944461-37944483 GTCTGAGCAACTTTGGAGACAGG 0: 1
1: 0
2: 0
3: 21
4: 369
1125271563_1125271567 26 Left 1125271563 15:37944435-37944457 CCATGATGGTTCAATGACCTAGT 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1125271567 15:37944484-37944506 ATGCCTGAGAACTGACTGTTTGG 0: 1
1: 0
2: 3
3: 8
4: 143
1125271563_1125271565 -4 Left 1125271563 15:37944435-37944457 CCATGATGGTTCAATGACCTAGT 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1125271565 15:37944454-37944476 TAGTGATGTCTGAGCAACTTTGG 0: 1
1: 0
2: 2
3: 11
4: 99
1125271563_1125271569 30 Left 1125271563 15:37944435-37944457 CCATGATGGTTCAATGACCTAGT 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1125271569 15:37944488-37944510 CTGAGAACTGACTGTTTGGCAGG 0: 1
1: 0
2: 1
3: 32
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125271563 Original CRISPR ACTAGGTCATTGAACCATCA TGG (reversed) Intronic
901096324 1:6683031-6683053 AGTAGTTCATGGAACCTTCAAGG - Intronic
902195901 1:14797821-14797843 ACTATTTCATTGAATCCTCACGG - Intronic
903385476 1:22923504-22923526 AGGAGGTGATTGAACCATGAGGG + Intergenic
904556079 1:31365416-31365438 ACTAGGTCATTTGACCATGGAGG + Intergenic
905023775 1:34836272-34836294 ACCAGGTCATTGACCCATAAAGG - Intronic
906431257 1:45757492-45757514 CCTAGGTCATTGAAGCAAAAAGG - Intergenic
909530421 1:76675632-76675654 ACAAGGTCATTCTACAATCAGGG + Intergenic
909651942 1:77985162-77985184 AATAGGTTATTGAAAGATCAAGG + Intronic
910358878 1:86395428-86395450 TCTAGGTCACTGAACCTTCCTGG - Intronic
910488229 1:87739106-87739128 AATGGGTCATTGTACCAACATGG + Intergenic
915266530 1:154722214-154722236 CGTAGGTCTTTGAAGCATCAAGG + Intronic
917160235 1:172049208-172049230 TCTAGGTCATTGAAACCCCAAGG - Intronic
924698608 1:246427074-246427096 ACTAGATCATTCAGCCATCCAGG + Intronic
1071197903 10:83182880-83182902 ATTAGGTTATTGTATCATCAGGG - Intergenic
1071384420 10:85105038-85105060 ACAAGGTCACAGAAACATCATGG + Intergenic
1072328787 10:94325109-94325131 AGTAAGTCATTGCACCATCCTGG + Intronic
1073260389 10:102185554-102185576 AATATGTTATTGAAACATCAGGG - Intergenic
1079200448 11:18372866-18372888 ATTAGCTCATTTAACCTTCACGG - Intergenic
1079385963 11:19980046-19980068 ACTAGGTCCTTCAGCCAGCAAGG + Intronic
1079624612 11:22600931-22600953 ACTAGGGCATTTAACCTTCAAGG + Intergenic
1080102413 11:28474874-28474896 ACTTGGTCATTGAACCTCCCAGG + Intergenic
1083083381 11:60116330-60116352 ACTGGGTGATTGAGCCATAAAGG + Intergenic
1086922134 11:92599402-92599424 AGGAGGTCATTGAATCATGAGGG - Intronic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1091744179 12:2980758-2980780 AATAGGTCAAAGAAGCATCATGG + Intronic
1094073214 12:26442580-26442602 AATAGGTCATCAAACCATGAAGG - Intronic
1107274867 13:38666801-38666823 AGGAGGTAATTGAACCATGAGGG + Intergenic
1125271563 15:37944435-37944457 ACTAGGTCATTGAACCATCATGG - Intronic
1127040196 15:54966824-54966846 GCTAGGTCATGGACCCACCATGG + Intergenic
1127716340 15:61652908-61652930 ACTAGTTCATTGAGCAATCCAGG - Intergenic
1130362041 15:83198188-83198210 ATTAGGTCATTGAACTATCCAGG - Intronic
1132022056 15:98371248-98371270 AGGAGGCCATTGTACCATCATGG - Intergenic
1132093257 15:98962610-98962632 ACCCGGTCATTCCACCATCAAGG - Exonic
1133563406 16:6970389-6970411 ACTAAGTCAGTGAAACATTAAGG - Intronic
1139808763 16:69593923-69593945 ACTAGGTTAATGAACAACCAGGG - Intronic
1140560713 16:75977599-75977621 ACTAGATCATTTAAACATGAAGG + Intergenic
1149346398 17:55740702-55740724 AGAAGGTCACTGAATCATCAGGG + Intergenic
1156755430 18:40518362-40518384 GCTTGGTCAATGAATCATCAGGG + Intergenic
1158924703 18:62243130-62243152 ACTAAGACATTGCATCATCAGGG - Intronic
1163513585 19:17749796-17749818 AGTGGGTCATTGAAACAGCATGG + Intronic
1164443815 19:28300262-28300284 AAAAAGTCATTGAATCATCAGGG + Intergenic
1166925450 19:46263924-46263946 AGTTGGGCATTAAACCATCAAGG - Intergenic
929305655 2:40358468-40358490 TTTAGTTCATTGAAGCATCAAGG + Intronic
937877870 2:126839011-126839033 ATTAGCTCATTTAACCCTCATGG + Intergenic
939037253 2:137148086-137148108 AGCAGGTAATTGAACCATGAGGG + Intronic
940191203 2:151042028-151042050 ACAAGACAATTGAACCATCAAGG + Intronic
948151527 2:235748357-235748379 CCTAGAGCATTGAAACATCATGG + Intronic
948260612 2:236601945-236601967 ACCAGGGCATGGAACCATGAGGG + Intergenic
1169594069 20:7177913-7177935 AGTAGGTAATTGAACCATGGGGG - Intergenic
1174558610 20:51413903-51413925 ATTAGCTCATTTAACCCTCATGG - Intronic
1178000534 21:28157875-28157897 GATAGGTCATTGGACCAACAGGG - Intergenic
1185076803 22:48687524-48687546 ACTAGGACCTGGATCCATCAAGG - Intronic
959943944 3:112107988-112108010 AATAGGTCATTAAGCCATAATGG + Intronic
960460228 3:117925191-117925213 ACTAGGATAATGAACCATGAGGG - Intergenic
964670087 3:159215338-159215360 AGCAGGTCATTAAACCTTCATGG - Intronic
970344163 4:15137081-15137103 GGTAGGTAATTGAATCATCAGGG - Intergenic
970662878 4:18305718-18305740 AGGAGGTCATTGAATCATGAGGG + Intergenic
977445941 4:97131925-97131947 TCTATGTCATTAAATCATCAAGG + Intergenic
977989417 4:103422652-103422674 ACTAGAACACTGAATCATCATGG + Intergenic
980561493 4:134482447-134482469 AATAGGTCATTTTACCTTCAAGG - Intergenic
983728651 4:170964874-170964896 ACTAGGTAATTGTATCATGAGGG + Intergenic
987190957 5:15477910-15477932 AGGAGGTAATTGAATCATCAGGG + Intergenic
987871941 5:23630833-23630855 ACTGGGTTCTTGCACCATCAAGG + Intergenic
988902271 5:35745873-35745895 AATAGACCATTAAACCATCAAGG + Intronic
989327156 5:40211752-40211774 ACTAGCTCATTCTGCCATCAAGG + Intergenic
990141378 5:52708127-52708149 TCAATGTCATTGAAGCATCAAGG + Intergenic
992649052 5:78839289-78839311 ACTAGGTAATCAAACCATCTTGG + Intronic
1000429311 5:161132367-161132389 ACTAGCTCATGTAACCCTCATGG + Intergenic
1003320644 6:5048034-5048056 TCTGGGTCATTGAACGGTCATGG + Intergenic
1003674935 6:8194328-8194350 ACCATGTCATTGAACCAACCTGG - Intergenic
1005176940 6:23057990-23058012 GGTAGGTCATTGAATCATGAGGG + Intergenic
1005479931 6:26246139-26246161 ATTAGATCATTGAACTAGCAAGG + Intergenic
1010363499 6:75022668-75022690 AAGAGGTCACTGAACCATGAGGG + Intergenic
1010788926 6:80041166-80041188 ACTAGGTGTTTGAAAAATCATGG - Intronic
1011344740 6:86356645-86356667 ACTAGGGCATTGAAACTGCAGGG - Intergenic
1013178460 6:107698162-107698184 ACCAGGTCACTTAACCTTCAGGG + Intergenic
1015193525 6:130498944-130498966 ACTTGGTCTTTGAACCTCCACGG - Intergenic
1019106672 6:169673504-169673526 ACTAGGTCGTTGAAGAATTATGG + Intronic
1019615850 7:1960931-1960953 ACTATGTTATAGGACCATCATGG + Intronic
1024489618 7:49964870-49964892 GCTAGGTCATAAAAACATCATGG + Intronic
1024653900 7:51432639-51432661 ACTTGGTCATTGAAACATGTAGG + Intergenic
1030453269 7:109740308-109740330 AAGAGGTAATTGAAACATCATGG - Intergenic
1031085273 7:117296331-117296353 ACTAGCTCATCAAACCATGAAGG + Intronic
1034761477 7:153676054-153676076 ATTAGGTTAGTGAACCACCAAGG - Intergenic
1036196497 8:6720929-6720951 ACTAGGTGTTTGGACCATCACGG - Intronic
1037810514 8:22083829-22083851 TCAAGGTCATTGAACCCTAAGGG + Intergenic
1039273679 8:35911149-35911171 AGGAGGTAATTGAACCATGAGGG - Intergenic
1048881509 8:138876188-138876210 ACATGGTCAATGAACCATGATGG - Intronic
1052046195 9:23797067-23797089 ATTAGGACATTGAAGCATAAAGG - Intronic
1062715709 9:138009122-138009144 ACCAGGTCCTTGTCCCATCACGG - Intronic
1188099166 X:26061497-26061519 ACTTGGTATTTGAACCATAAAGG - Intergenic