ID: 1125276960

View in Genome Browser
Species Human (GRCh38)
Location 15:38003715-38003737
Sequence CCTTGGGCCTTGAGTGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125276960_1125276964 -3 Left 1125276960 15:38003715-38003737 CCATGTTCACTCAAGGCCCAAGG No data
Right 1125276964 15:38003735-38003757 AGGACTCTTCAGTCAGCTTGTGG 0: 15
1: 141
2: 326
3: 496
4: 544
1125276960_1125276966 16 Left 1125276960 15:38003715-38003737 CCATGTTCACTCAAGGCCCAAGG No data
Right 1125276966 15:38003754-38003776 GTGGTGCATGTTACCAGGCCTGG No data
1125276960_1125276965 11 Left 1125276960 15:38003715-38003737 CCATGTTCACTCAAGGCCCAAGG No data
Right 1125276965 15:38003749-38003771 AGCTTGTGGTGCATGTTACCAGG No data
1125276960_1125276967 17 Left 1125276960 15:38003715-38003737 CCATGTTCACTCAAGGCCCAAGG No data
Right 1125276967 15:38003755-38003777 TGGTGCATGTTACCAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125276960 Original CRISPR CCTTGGGCCTTGAGTGAACA TGG (reversed) Intergenic
No off target data available for this crispr