ID: 1125277590

View in Genome Browser
Species Human (GRCh38)
Location 15:38009781-38009803
Sequence CTGTATATATAAATGAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125277587_1125277590 15 Left 1125277587 15:38009743-38009765 CCTGAGTCAAGTCACTCAAGCTC No data
Right 1125277590 15:38009781-38009803 CTGTATATATAAATGAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125277590 Original CRISPR CTGTATATATAAATGAGGCA TGG Intergenic
No off target data available for this crispr