ID: 1125281015

View in Genome Browser
Species Human (GRCh38)
Location 15:38042809-38042831
Sequence CCTCCGAGGCCCCACCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125281007_1125281015 -6 Left 1125281007 15:38042792-38042814 CCCACGTTCCCACTCCTCCTCCG No data
Right 1125281015 15:38042809-38042831 CCTCCGAGGCCCCACCTTCAGGG No data
1125281004_1125281015 -3 Left 1125281004 15:38042789-38042811 CCCCCCACGTTCCCACTCCTCCT No data
Right 1125281015 15:38042809-38042831 CCTCCGAGGCCCCACCTTCAGGG No data
1125281006_1125281015 -5 Left 1125281006 15:38042791-38042813 CCCCACGTTCCCACTCCTCCTCC No data
Right 1125281015 15:38042809-38042831 CCTCCGAGGCCCCACCTTCAGGG No data
1125281005_1125281015 -4 Left 1125281005 15:38042790-38042812 CCCCCACGTTCCCACTCCTCCTC No data
Right 1125281015 15:38042809-38042831 CCTCCGAGGCCCCACCTTCAGGG No data
1125281003_1125281015 17 Left 1125281003 15:38042769-38042791 CCTCTTCTAGCTCTAAAATTCCC No data
Right 1125281015 15:38042809-38042831 CCTCCGAGGCCCCACCTTCAGGG No data
1125281008_1125281015 -7 Left 1125281008 15:38042793-38042815 CCACGTTCCCACTCCTCCTCCGA No data
Right 1125281015 15:38042809-38042831 CCTCCGAGGCCCCACCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125281015 Original CRISPR CCTCCGAGGCCCCACCTTCA GGG Intergenic
No off target data available for this crispr