ID: 1125281587

View in Genome Browser
Species Human (GRCh38)
Location 15:38047549-38047571
Sequence CAGGAGGAAAAGAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125281581_1125281587 -8 Left 1125281581 15:38047534-38047556 CCTACATGGCTGAAGCAGGAGGA No data
Right 1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125281587 Original CRISPR CAGGAGGAAAAGAGGGAAGG GGG Intergenic
No off target data available for this crispr