ID: 1125281670

View in Genome Browser
Species Human (GRCh38)
Location 15:38048076-38048098
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125281670_1125281671 25 Left 1125281670 15:38048076-38048098 CCTGAAGACTGAGATCAAATACG No data
Right 1125281671 15:38048124-38048146 TAGAGCCCCAGTAATAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125281670 Original CRISPR CGTATTTGATCTCAGTCTTC AGG (reversed) Intergenic
No off target data available for this crispr