ID: 1125283104

View in Genome Browser
Species Human (GRCh38)
Location 15:38064171-38064193
Sequence CCTTATAAGAAGAGGAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3138
Summary {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125283104 Original CRISPR CCTTATAAGAAGAGGAAATC TGG Intergenic
Too many off-targets to display for this crispr