ID: 1125286271

View in Genome Browser
Species Human (GRCh38)
Location 15:38095889-38095911
Sequence GATTGGAGCTAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125286271_1125286276 -3 Left 1125286271 15:38095889-38095911 CCCTCTTCCCTCTAGCTCCAATC No data
Right 1125286276 15:38095909-38095931 ATCTGAACCATTTCCTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125286271 Original CRISPR GATTGGAGCTAGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr