ID: 1125287528

View in Genome Browser
Species Human (GRCh38)
Location 15:38110042-38110064
Sequence TTTTATGGGTTCATCTGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125287528_1125287534 -5 Left 1125287528 15:38110042-38110064 CCTGATCAGATGAACCCATAAAA No data
Right 1125287534 15:38110060-38110082 TAAAAAAAGACAGGGCTGGCCGG No data
1125287528_1125287537 4 Left 1125287528 15:38110042-38110064 CCTGATCAGATGAACCCATAAAA No data
Right 1125287537 15:38110069-38110091 ACAGGGCTGGCCGGGAGTGGTGG No data
1125287528_1125287536 1 Left 1125287528 15:38110042-38110064 CCTGATCAGATGAACCCATAAAA No data
Right 1125287536 15:38110066-38110088 AAGACAGGGCTGGCCGGGAGTGG No data
1125287528_1125287535 -4 Left 1125287528 15:38110042-38110064 CCTGATCAGATGAACCCATAAAA No data
Right 1125287535 15:38110061-38110083 AAAAAAAGACAGGGCTGGCCGGG No data
1125287528_1125287532 -9 Left 1125287528 15:38110042-38110064 CCTGATCAGATGAACCCATAAAA No data
Right 1125287532 15:38110056-38110078 CCCATAAAAAAAGACAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125287528 Original CRISPR TTTTATGGGTTCATCTGATC AGG (reversed) Intergenic
No off target data available for this crispr