ID: 1125297735

View in Genome Browser
Species Human (GRCh38)
Location 15:38221213-38221235
Sequence CCCTCTCCTTAGCTTAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125297735_1125297738 5 Left 1125297735 15:38221213-38221235 CCAGGCCTAAGCTAAGGAGAGGG No data
Right 1125297738 15:38221241-38221263 GTTTAAAGTCAGATATGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125297735 Original CRISPR CCCTCTCCTTAGCTTAGGCC TGG (reversed) Intergenic
No off target data available for this crispr