ID: 1125302223

View in Genome Browser
Species Human (GRCh38)
Location 15:38268313-38268335
Sequence CTAAGGATGTACCTCCGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125302223_1125302228 20 Left 1125302223 15:38268313-38268335 CCAACACGGAGGTACATCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1125302228 15:38268356-38268378 ACTTCACAGTAGTTTAGAACAGG 0: 1
1: 0
2: 1
3: 8
4: 146
1125302223_1125302229 21 Left 1125302223 15:38268313-38268335 CCAACACGGAGGTACATCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1125302229 15:38268357-38268379 CTTCACAGTAGTTTAGAACAGGG 0: 1
1: 0
2: 0
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125302223 Original CRISPR CTAAGGATGTACCTCCGTGT TGG (reversed) Intronic
906456638 1:46002920-46002942 CTAAGGAAGTACTTCCCTTTGGG + Intronic
907904078 1:58768314-58768336 CTAAGGTTGTAATTCCGTCTTGG + Intergenic
916263834 1:162869626-162869648 CTATGGATGTAACTTCCTGTGGG - Intergenic
919865236 1:201776877-201776899 CTAATGATGTGCCTTGGTGTGGG - Intronic
922368938 1:224890631-224890653 ATATGGATGTACCTTCTTGTTGG + Intergenic
1081182610 11:40002961-40002983 CTAAGAGTGTACCTCTGTGACGG + Intergenic
1082854631 11:57795641-57795663 CTCAGGATCCTCCTCCGTGTAGG - Exonic
1084581648 11:70027849-70027871 CTAAGGATGCGCCTCCGTGGTGG - Intergenic
1087259453 11:95994264-95994286 CAAAGGATGTACCTCAGAGATGG - Intronic
1092261254 12:6954341-6954363 CTAAGGATGAATCTCCGTGAAGG - Intronic
1098859366 12:75690084-75690106 CTCAGGATTTACTTCCTTGTGGG - Intergenic
1111534526 13:89585582-89585604 GAAAGGATGTGCCTCAGTGTTGG - Intergenic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1127521078 15:59743540-59743562 CTAAGGATCTGCCTCCAAGTTGG + Intergenic
1129512992 15:76138621-76138643 CTAAGCATGTTCCTGCATGTAGG - Intronic
1149375445 17:56039310-56039332 CTAAACATGTACCTCAGTCTTGG + Intergenic
1155400122 18:25429028-25429050 CTAGGGATGAATCTCTGTGTGGG + Intergenic
931748558 2:65311549-65311571 CCAAGGAAGTGCCTCCGGGTCGG + Exonic
939166200 2:138643665-138643687 CCCAGGATGCACCTACGTGTGGG + Intergenic
940337523 2:152544786-152544808 CTAAGCATCTTCCTCCATGTGGG - Intronic
940885525 2:158986435-158986457 CTAATGATATACCTCCAGGTAGG + Intronic
941851008 2:170180182-170180204 GTAAGGCTGTACCTCCGTTAGGG + Intronic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1174541092 20:51290047-51290069 CTAATGATGCACCCCGGTGTGGG - Intergenic
1177181178 21:17746184-17746206 ATAAGGATGTTCCTTCCTGTGGG + Intergenic
1183787167 22:40036415-40036437 CTAAGGATGAACCTGCATGAGGG - Exonic
949995563 3:9613882-9613904 CTAAGGAGGTACTGCCATGTAGG - Intergenic
959137087 3:102436855-102436877 CTTAGGATACACCTCTGTGTTGG + Intronic
985632056 5:1018880-1018902 CCAAGGATGTTCCTCCCTGTGGG - Intronic
991213901 5:64138830-64138852 TTGAGTATGTACCTCAGTGTGGG - Intergenic
994970418 5:106730437-106730459 CCAAGGATGTCCATCCCTGTAGG + Intergenic
997157798 5:131577436-131577458 ATATGGATGTACCTTCTTGTTGG + Intronic
1014954833 6:127601932-127601954 CTAAATATGTACCTCCCTTTTGG + Intergenic
1017129458 6:151095531-151095553 CTAAGGATGTATCCCTGAGTAGG - Intronic
1049205392 8:141361231-141361253 CCAAGGAAGTACCTGTGTGTGGG - Intronic
1057514270 9:95708224-95708246 CTAAGGTTGACCCTCCATGTGGG + Intergenic
1057800082 9:98185650-98185672 CTAAGGCTGCACCACGGTGTTGG - Intronic
1059420841 9:114191099-114191121 TCAAGGATTTACCTCCGTCTAGG + Intronic