ID: 1125302223

View in Genome Browser
Species Human (GRCh38)
Location 15:38268313-38268335
Sequence CTAAGGATGTACCTCCGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125302223_1125302229 21 Left 1125302223 15:38268313-38268335 CCAACACGGAGGTACATCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1125302229 15:38268357-38268379 CTTCACAGTAGTTTAGAACAGGG 0: 1
1: 0
2: 0
3: 11
4: 182
1125302223_1125302228 20 Left 1125302223 15:38268313-38268335 CCAACACGGAGGTACATCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1125302228 15:38268356-38268378 ACTTCACAGTAGTTTAGAACAGG 0: 1
1: 0
2: 1
3: 8
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125302223 Original CRISPR CTAAGGATGTACCTCCGTGT TGG (reversed) Intronic