ID: 1125302225

View in Genome Browser
Species Human (GRCh38)
Location 15:38268330-38268352
Sequence TGGGATGTTGTTCTCCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125302225_1125302230 17 Left 1125302225 15:38268330-38268352 CCTTAGAGGAGAACAACATCCCA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1125302230 15:38268370-38268392 TAGAACAGGGAATTTTTCAATGG 0: 1
1: 1
2: 3
3: 36
4: 315
1125302225_1125302229 4 Left 1125302225 15:38268330-38268352 CCTTAGAGGAGAACAACATCCCA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1125302229 15:38268357-38268379 CTTCACAGTAGTTTAGAACAGGG 0: 1
1: 0
2: 0
3: 11
4: 182
1125302225_1125302228 3 Left 1125302225 15:38268330-38268352 CCTTAGAGGAGAACAACATCCCA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1125302228 15:38268356-38268378 ACTTCACAGTAGTTTAGAACAGG 0: 1
1: 0
2: 1
3: 8
4: 146
1125302225_1125302231 23 Left 1125302225 15:38268330-38268352 CCTTAGAGGAGAACAACATCCCA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1125302231 15:38268376-38268398 AGGGAATTTTTCAATGGCAATGG 0: 1
1: 0
2: 2
3: 28
4: 293
1125302225_1125302232 24 Left 1125302225 15:38268330-38268352 CCTTAGAGGAGAACAACATCCCA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1125302232 15:38268377-38268399 GGGAATTTTTCAATGGCAATGGG 0: 1
1: 0
2: 1
3: 15
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125302225 Original CRISPR TGGGATGTTGTTCTCCTCTA AGG (reversed) Intronic