ID: 1125302228

View in Genome Browser
Species Human (GRCh38)
Location 15:38268356-38268378
Sequence ACTTCACAGTAGTTTAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125302225_1125302228 3 Left 1125302225 15:38268330-38268352 CCTTAGAGGAGAACAACATCCCA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1125302228 15:38268356-38268378 ACTTCACAGTAGTTTAGAACAGG 0: 1
1: 0
2: 1
3: 8
4: 146
1125302223_1125302228 20 Left 1125302223 15:38268313-38268335 CCAACACGGAGGTACATCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1125302228 15:38268356-38268378 ACTTCACAGTAGTTTAGAACAGG 0: 1
1: 0
2: 1
3: 8
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125302228 Original CRISPR ACTTCACAGTAGTTTAGAAC AGG Intronic
901601740 1:10428044-10428066 ACTTCCCAGTAGTTTAGCCTTGG + Intergenic
907791689 1:57672170-57672192 ACTTCAAAGTCCATTAGAACTGG - Intronic
909252129 1:73371547-73371569 ACTTCTCACTAGTTAAGAAGTGG + Intergenic
913607185 1:120476921-120476943 ACCTCACACTAGCTTATAACTGG + Intergenic
914209248 1:145563226-145563248 ACCTCACACTAGCTTATAACTGG - Intergenic
914268165 1:146055592-146055614 ACCTCACACTAGCTTATAACTGG - Intergenic
914368929 1:147005270-147005292 ACCTCACACTAGCTTATAACTGG + Intergenic
914584008 1:149044917-149044939 ACCTCACACTAGCTTATAACTGG - Intronic
919538745 1:198822241-198822263 AAATCACAGTAGTTTTGAAGTGG + Intergenic
920645223 1:207798307-207798329 TGTTTACAGTAGTTTAGCACAGG - Intergenic
1066366310 10:34780085-34780107 ACTTCACAGTAGTTTCCATGGGG - Intronic
1067277487 10:44848294-44848316 CCTGCACACTAGGTTAGAACAGG - Intergenic
1071685925 10:87756383-87756405 ACTTCACTATACTTTGGAACTGG + Intronic
1072262064 10:93687828-93687850 ACTTAACAGTTGTATAGTACTGG + Intronic
1074096854 10:110321195-110321217 ACTTGACAGAAGATTAGAAATGG + Intergenic
1074327828 10:112470105-112470127 TGTTCACAGTTGTGTAGAACAGG + Intronic
1078172637 11:8940386-8940408 AAGTAACAGTAGTTTAAAACAGG - Intergenic
1079551692 11:21706953-21706975 ACTCCACAGTAGTTAAGTGCTGG - Intergenic
1080868226 11:36213876-36213898 CCTTCACACTAGATTAAAACGGG - Intronic
1082676107 11:56105015-56105037 ATTTCTCAGCAGTTTAGAGCAGG + Intronic
1082677350 11:56122345-56122367 ATTTCTCAGCAGTTTAGAGCAGG + Intergenic
1085240307 11:75047781-75047803 ATACCACAGTAGATTAGAACTGG - Intergenic
1085978342 11:81690031-81690053 ATTTAACAGTAGATTAGAAAAGG - Intergenic
1087965449 11:104407434-104407456 ATTTCACAGTGTTTTAGAAAAGG - Intergenic
1089620359 11:119718521-119718543 ACCTTCCAGAAGTTTAGAACAGG + Intronic
1095286195 12:40413679-40413701 ACTTCCCAGGAGCTTAGACCTGG + Intronic
1098953822 12:76668399-76668421 ACTCCACAGTAGTTCAAAATAGG - Intergenic
1100123145 12:91392937-91392959 ACTTCACAGTAGAGAAGTACAGG - Intergenic
1100660325 12:96690279-96690301 ACTACAAAGTATTTTAGAATAGG + Intronic
1103103758 12:118204696-118204718 ACATCATAGAATTTTAGAACGGG + Intronic
1107258920 13:38467476-38467498 ACTTCTCATTACTTTAGAGCGGG + Intergenic
1110046176 13:70834308-70834330 ACTTCACTGTAGTCTTGAATTGG + Intergenic
1110087674 13:71402612-71402634 ATTTCACAGTAGTTTAGAAATGG + Intergenic
1110423764 13:75341922-75341944 ACTGCACAGTGGTTTAAAACAGG + Intronic
1110423849 13:75343335-75343357 ACTGCACAGTGGTTTAAAGCAGG - Intronic
1112737823 13:102440931-102440953 AATTCACAGGAGTTTACAAATGG + Intergenic
1112863779 13:103868811-103868833 AGTGTAGAGTAGTTTAGAACAGG + Intergenic
1113132168 13:107050135-107050157 ACTTCACATTAGATTAGGAATGG - Intergenic
1113169471 13:107483587-107483609 ACTTCAGATTATTTTAGAATAGG + Intronic
1115052198 14:29076437-29076459 TATTCACAGTAGTTAAAAACTGG + Intergenic
1115738802 14:36364985-36365007 AGATCACAGTATTTTAGAATTGG + Intergenic
1116887278 14:50233131-50233153 ACATCACAGTAGTTTATAGCTGG - Intergenic
1125302228 15:38268356-38268378 ACTTCACAGTAGTTTAGAACAGG + Intronic
1126273830 15:46852181-46852203 ACTTTACAATAGAGTAGAACTGG - Intergenic
1130455535 15:84102991-84103013 CCTTAAGAGTATTTTAGAACAGG + Intergenic
1130906964 15:88247508-88247530 TCTTCCCAGTAGTCTAGAAAAGG + Intronic
1133959407 16:10479930-10479952 ATTTCTCAGTGATTTAGAACTGG + Intronic
1137636825 16:49993970-49993992 TCTTCATAGTATTTTAGAAAGGG + Intergenic
1137901956 16:52278327-52278349 AGTTCAATGTAGTTTAGAAGGGG - Intergenic
1140239518 16:73188577-73188599 ACTTCACAATAGTTTAGTCAGGG - Intergenic
1142842222 17:2642031-2642053 ACTTATCAGTAGTTTTCAACTGG - Intronic
1146951037 17:36906497-36906519 GCTGCACAGCAATTTAGAACTGG + Intergenic
1148946946 17:51271168-51271190 ACTTCATAGTACTTTTGAACTGG + Intronic
1152011438 17:77721205-77721227 CCTGCACAGTAGCTTAGACCAGG - Intergenic
1153214503 18:2807035-2807057 GCTTAACAGTAGGTTTGAACTGG + Intergenic
1155625658 18:27831748-27831770 ACTTGACAGTAGCTTAGATGTGG - Intergenic
1155796320 18:30042079-30042101 ACTACACAGTGTTTTAGAAAGGG - Intergenic
1156182508 18:34622329-34622351 AAATCACACTAGTTTAAAACCGG - Intronic
1156944448 18:42812278-42812300 ACATCACAGTAGTCCAGAAATGG + Intronic
1158236789 18:55324608-55324630 TTTTCACAGTAGTGTATAACTGG + Intronic
1165290284 19:34878296-34878318 ACTCCACAGTAGTAAAGAAATGG - Intergenic
1202709073 1_KI270714v1_random:6658-6680 ACCTCACACTAGCTTATAACTGG + Intergenic
925892546 2:8447532-8447554 AGTTCACAGAATTTCAGAACCGG + Intergenic
929303473 2:40332700-40332722 ACTTCACAGGATTTTTAAACAGG - Intronic
930489206 2:52046665-52046687 ACCTCACAGTCCATTAGAACTGG + Intergenic
930906428 2:56573769-56573791 ACTTCATAGTAGTTAAGGACTGG - Intergenic
932355733 2:71067388-71067410 AATTCACAGCACTTTAGAGCTGG - Intronic
937759395 2:125582156-125582178 TCTTCACAGGAGTTTGGAAGTGG - Intergenic
937792970 2:125981974-125981996 CCTTCAGAGTAATTCAGAACTGG - Intergenic
939094266 2:137815943-137815965 ACTTGTCAGAAGCTTAGAACAGG - Intergenic
940813868 2:158277011-158277033 AAATCACAGAAGTTTAGAGCTGG + Intronic
945230807 2:207587508-207587530 ACTTCACAGTAGCTAAGATAGGG + Intronic
947053440 2:226073859-226073881 AAGTCACAGAAGTTTAAAACTGG + Intergenic
1169312899 20:4562253-4562275 AATACTCAGTAGTTTAAAACAGG + Intergenic
1174470504 20:50756724-50756746 ACTTCACAGTGTTTTCAAACAGG - Intronic
1176877827 21:14150918-14150940 ATTTAACAGTCGTATAGAACTGG - Intronic
1177130991 21:17255206-17255228 AGTTGACAGGAGTTTAGAAGTGG + Intergenic
1182684224 22:32108850-32108872 ACATCACAGAATTTTAGAACTGG - Intronic
1182955456 22:34420098-34420120 AAATGACAGTATTTTAGAACTGG - Intergenic
1183789622 22:40055522-40055544 ACTCCACTGCAGTTTAGGACAGG + Intronic
949117560 3:345853-345875 ACTTAACAGTAGTTAATAAATGG - Intronic
949333828 3:2951536-2951558 TTTACACAGTAGTCTAGAACAGG - Intronic
956546377 3:70407976-70407998 AGTTCACAGAAGTCAAGAACTGG - Intergenic
956759872 3:72431524-72431546 ATAACACAGTATTTTAGAACTGG + Intronic
960423400 3:117476745-117476767 ACTTCACAGCACTTGAGAACAGG - Intergenic
962244482 3:133780584-133780606 ATTTTACAGTGTTTTAGAACAGG + Intergenic
964874554 3:161351406-161351428 AGTTCACTGGAGTTTAGAATAGG - Intronic
967744070 3:193035290-193035312 ATTTCAGAGTAGGTTAGTACAGG + Intergenic
968045297 3:195620573-195620595 ACTTCACAGAAGGTCAGAGCTGG - Intergenic
968061152 3:195726916-195726938 ACTTCACAGAAGGTCAGAGCTGG - Intronic
970043245 4:11820658-11820680 ACTTCCTAGAAGTTTTGAACTGG - Intergenic
970253187 4:14138314-14138336 ACTTCAGGGTAGTTTAGCAATGG - Intergenic
971580999 4:28340607-28340629 AATTCATAGTATTTTAGAAATGG + Intergenic
971607307 4:28674466-28674488 ATTTCACAGAAGATTAGAATTGG + Intergenic
972635730 4:40882470-40882492 ACTTCACAGAAATGCAGAACTGG - Intronic
972701563 4:41499021-41499043 ATTCCACAGTCCTTTAGAACTGG - Intronic
975567508 4:75774587-75774609 AAATCACAGAATTTTAGAACTGG - Intronic
975616723 4:76254195-76254217 ACTTCATAGAATGTTAGAACTGG - Intronic
976137620 4:81955864-81955886 ACTAGACACCAGTTTAGAACTGG - Intronic
978895963 4:113887537-113887559 AGTTCAAAGTAGTGTAGAATAGG - Intergenic
981827594 4:148961403-148961425 ATCTCACAGTAGTTATGAACCGG + Intergenic
983288436 4:165769636-165769658 TCTTCACAGTAGTTAAGATAAGG + Intergenic
986287265 5:6369019-6369041 ACTTCATATTAGTGAAGAACTGG + Intergenic
986351956 5:6888662-6888684 AATACACCGTATTTTAGAACAGG - Intergenic
987932503 5:24419938-24419960 AATTCAAAATAGTTTAAAACAGG - Intergenic
988124746 5:27015098-27015120 ACTTTACAGTGTTTTAGAAATGG - Intronic
989172715 5:38488980-38489002 CCTGCTCAGTAGTTTAGTACTGG - Intronic
989728033 5:44610858-44610880 ATTTCACAGTAGTTTTTATCAGG - Intergenic
992589466 5:78278658-78278680 ATTACACAGTGGTTTAAAACAGG + Intronic
994065294 5:95533311-95533333 ACTTCACAGCAGTTAATCACTGG - Intronic
994823914 5:104688047-104688069 ACTTCACTGCACCTTAGAACTGG - Intergenic
994953924 5:106502115-106502137 ACATGACAGTAGCTTAGAAGAGG - Intergenic
995075316 5:107976608-107976630 TCTTCATTGTTGTTTAGAACAGG - Intronic
995488124 5:112659446-112659468 ACTTCAGATTGGTTAAGAACAGG - Intergenic
997450685 5:133980604-133980626 ACTTTACAGTGGTTAAAAACTGG + Intronic
1002437920 5:179243902-179243924 GCTTAACAGTAGATTGGAACTGG + Intronic
1005201569 6:23350819-23350841 ACTTCAGATTAATTCAGAACAGG - Intergenic
1005852981 6:29836326-29836348 ACTTCACAGTTGTTTTGAGGAGG - Intergenic
1005876583 6:30014832-30014854 ACTTCACAGTTGTTTTGAGAAGG - Intergenic
1008906962 6:56688939-56688961 AATTCACAGAAATTTAAAACTGG + Intronic
1010709376 6:79154625-79154647 ACTTCACAGGACATTAGAAGGGG - Intergenic
1011047125 6:83096931-83096953 ACTTTACATGAGTTTGGAACTGG + Exonic
1015733724 6:136375356-136375378 ACAATACAGTAGTTGAGAACTGG - Intronic
1017568919 6:155721025-155721047 ACTTAACATTAGTGTAGATCTGG - Intergenic
1020766033 7:12322526-12322548 ATTTTACAGAAGTTTAAAACAGG + Intergenic
1022055877 7:26734017-26734039 AACACACAATAGTTTAGAACAGG + Intronic
1024795659 7:53016692-53016714 AGTTGACAGTTGTCTAGAACTGG - Intergenic
1027349140 7:77292805-77292827 AATTCACAGAAATTAAGAACTGG - Intronic
1027987060 7:85306721-85306743 ACTTCATAGAATTTTAGAATTGG + Intergenic
1032245420 7:130207074-130207096 AGTTCATAGTAGTTCATAACGGG + Intronic
1033225365 7:139558321-139558343 ACTTTACACTTGTTTGGAACAGG + Intergenic
1033633548 7:143186042-143186064 ACTTGAGAGTATTTCAGAACTGG + Intergenic
1035976912 8:4323185-4323207 TCTGCATAGGAGTTTAGAACTGG - Intronic
1036393778 8:8349143-8349165 AATTCAGAATATTTTAGAACAGG - Intronic
1037547360 8:19937715-19937737 ACTTCGCAGAACTTTAGAAGTGG - Intronic
1037912935 8:22754934-22754956 GATTCACAGTAGTTAAGAGCCGG - Intronic
1042248842 8:66736067-66736089 ATTTAACAGTAGTTAAGAATGGG + Intronic
1043487059 8:80708748-80708770 ACTTCATAATAGTGTAGAACTGG - Intronic
1045666010 8:104485484-104485506 AATTCACAGAATTTTAGAGCTGG - Intergenic
1047097692 8:121641636-121641658 AATTCATTGGAGTTTAGAACCGG - Intergenic
1047774977 8:128062507-128062529 AATTCACAGAAGGTGAGAACTGG + Intergenic
1048661449 8:136607171-136607193 TCTTCACTGTTGTTTAGAATTGG + Intergenic
1050832268 9:10029124-10029146 ACTACACAGAAGTCAAGAACTGG + Intronic
1051424381 9:16918842-16918864 TCTTCACAGCAGTATAGAAATGG - Intergenic
1051521470 9:17993549-17993571 ACTTCTCATTAGATTGGAACAGG - Intergenic
1051901720 9:22050219-22050241 ACTTCACAGGATTATAGAAAAGG - Intergenic
1053345334 9:37374035-37374057 ACTTTAGAGGAGTTAAGAACAGG + Intergenic
1055633048 9:78244072-78244094 ACTACAGAGTTGTTTATAACAGG - Intronic
1057485270 9:95477903-95477925 GCTTCACAGTGGTTTAAAAGTGG - Intronic
1057936991 9:99248729-99248751 AATTCATAGTATTTTAGAAAAGG + Intergenic
1057950275 9:99364359-99364381 ACTTCACATTTGTGAAGAACTGG - Intergenic
1187753586 X:22495202-22495224 ACATCACAGGATTTTAGAAGAGG + Intergenic
1189520324 X:41760307-41760329 ACATCACAGAATCTTAGAACTGG + Intronic
1189892566 X:45620456-45620478 AATTCACAGCAGTTTAGAATTGG + Intergenic
1196169539 X:112572619-112572641 TCATCACAGTATTTTACAACAGG + Intergenic
1197024764 X:121735871-121735893 ACTTCATAGTACTTGAGAGCAGG - Intergenic