ID: 1125302228

View in Genome Browser
Species Human (GRCh38)
Location 15:38268356-38268378
Sequence ACTTCACAGTAGTTTAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125302223_1125302228 20 Left 1125302223 15:38268313-38268335 CCAACACGGAGGTACATCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1125302228 15:38268356-38268378 ACTTCACAGTAGTTTAGAACAGG 0: 1
1: 0
2: 1
3: 8
4: 146
1125302225_1125302228 3 Left 1125302225 15:38268330-38268352 CCTTAGAGGAGAACAACATCCCA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1125302228 15:38268356-38268378 ACTTCACAGTAGTTTAGAACAGG 0: 1
1: 0
2: 1
3: 8
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125302228 Original CRISPR ACTTCACAGTAGTTTAGAAC AGG Intronic