ID: 1125302229

View in Genome Browser
Species Human (GRCh38)
Location 15:38268357-38268379
Sequence CTTCACAGTAGTTTAGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125302223_1125302229 21 Left 1125302223 15:38268313-38268335 CCAACACGGAGGTACATCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1125302229 15:38268357-38268379 CTTCACAGTAGTTTAGAACAGGG 0: 1
1: 0
2: 0
3: 11
4: 182
1125302225_1125302229 4 Left 1125302225 15:38268330-38268352 CCTTAGAGGAGAACAACATCCCA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1125302229 15:38268357-38268379 CTTCACAGTAGTTTAGAACAGGG 0: 1
1: 0
2: 0
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125302229 Original CRISPR CTTCACAGTAGTTTAGAACA GGG Intronic
900391099 1:2434315-2434337 CTTCACAGCCGTTTACAACCTGG + Intronic
904354491 1:29930360-29930382 CAGCACAGGAGTTTAGAACCTGG - Intergenic
910812700 1:91254090-91254112 CTTCATAGTAGTTGTGACCAAGG - Intergenic
911882118 1:103252728-103252750 CTTCACAGTAGATAAGTATAAGG - Intergenic
913193222 1:116431286-116431308 CATCACAGAAATTTATAACATGG - Intergenic
916427931 1:164699589-164699611 CTTCATAGTGCTTTAGAAAAGGG - Intronic
916861689 1:168812721-168812743 CTTCACAATATTATAGAACAAGG - Intergenic
918470576 1:184868813-184868835 TGGTACAGTAGTTTAGAACACGG + Intronic
918839368 1:189514094-189514116 CTTCACATTAGAATAGAATATGG - Intergenic
920645222 1:207798306-207798328 GTTTACAGTAGTTTAGCACAGGG - Intergenic
923643090 1:235785525-235785547 CCTCAAAGTAGATTAGACCATGG - Intronic
924182372 1:241451965-241451987 CTTCAGAATAGTGGAGAACATGG + Intergenic
1064647202 10:17471842-17471864 CTCCACATCAGTTTAGGACAAGG - Intergenic
1068000909 10:51332875-51332897 CATCACTGTAGAGTAGAACAGGG + Intronic
1068012705 10:51474202-51474224 CTTCTCACTAGTTATGAACATGG - Intronic
1070553614 10:77511418-77511440 TTTCATAGTAGTTAAGAAAATGG + Intronic
1072309835 10:94144226-94144248 TTTCCTAGTAGTTAAGAACATGG - Intronic
1074731589 10:116383060-116383082 CTCCACAGGAGCTTTGAACAGGG - Intergenic
1078426684 11:11257169-11257191 CTGGACAGTAGTTAAGAGCAAGG - Intergenic
1079046947 11:17113376-17113398 CATCACAGTGATTTAGAAGAAGG - Intronic
1080262427 11:30364095-30364117 TTTCACAGCAGTTTTAAACATGG - Intergenic
1084287721 11:68142653-68142675 GTTGACAGAAGTTCAGAACAAGG + Intergenic
1086120280 11:83298681-83298703 CTTCACAGAAATTTACAACAAGG + Intergenic
1089028078 11:115293053-115293075 CTTCACAGTAGTTTAAATGATGG - Intronic
1089887429 11:121841407-121841429 CTGCACAGTTTTTTAGGACAGGG - Intergenic
1090163069 11:124516397-124516419 CACCACAGTGGTATAGAACAGGG + Intergenic
1095992077 12:48042083-48042105 CTTCCCAGTAGTTCAGCACGTGG + Intergenic
1097306104 12:58070910-58070932 CCTCACAGTTGTTTAACACAAGG + Intergenic
1097925935 12:65126263-65126285 CTCCACAGCAGTGTAGTACAGGG - Intergenic
1100170862 12:91973690-91973712 CCTCAGAGTAGTTTACAACATGG - Intergenic
1100486327 12:95031348-95031370 CTTCACAATAGTCTTCAACAAGG - Exonic
1107162345 13:37245647-37245669 CTTCACAATGTTTTAGAAAATGG + Intergenic
1107926412 13:45266782-45266804 CTGAACAGTAGTTCAGAACCTGG - Intronic
1110149762 13:72237227-72237249 CTCCAGACCAGTTTAGAACATGG - Intergenic
1110663327 13:78085458-78085480 CTTTACAGATGATTAGAACAAGG + Intergenic
1111269296 13:85859907-85859929 CTTCACTGGATTTTTGAACATGG + Intergenic
1111812065 13:93103641-93103663 CTTCCCAGTGGTCTAGAACCTGG + Intergenic
1114572464 14:23682120-23682142 TATCGCAGCAGTTTAGAACAGGG - Intergenic
1119489456 14:75018218-75018240 CTTCACTGAAGATTATAACAAGG + Intronic
1120068886 14:80080049-80080071 CTTCACAGTAGTATATACAAGGG - Intergenic
1120266732 14:82260352-82260374 CTTAAAAGTAGATTAGAAAAAGG - Intergenic
1120569861 14:86104072-86104094 CTTCATAGTGGCTTTGAACAAGG + Intergenic
1120609047 14:86617444-86617466 ATTAACATTAGTTTGGAACAGGG + Intergenic
1121030081 14:90650787-90650809 CTTCACTATACTTTAGTACAGGG + Intronic
1121554237 14:94824271-94824293 CTGTACCGTAGTCTAGAACAGGG - Intergenic
1125302229 15:38268357-38268379 CTTCACAGTAGTTTAGAACAGGG + Intronic
1130113201 15:80983465-80983487 CTTCCCAGAAGTTAAGAACCTGG - Intronic
1131816967 15:96232157-96232179 CTACAGAGTAGCTTTGAACAAGG + Intergenic
1131881199 15:96864163-96864185 ATTCAGAGTATTTTAGAAAAAGG - Intergenic
1132532107 16:456983-457005 CTTCACACTAGATCAGCACATGG - Intronic
1137636826 16:49993971-49993993 CTTCATAGTATTTTAGAAAGGGG + Intergenic
1138847771 16:60587521-60587543 CTGTTCAGTAGTTTAGAAAATGG + Intergenic
1143589925 17:7877526-7877548 CTACACAGCAGTTAAGAAAAAGG - Intronic
1145120669 17:20256604-20256626 CTGCTCTGTAGCTTAGAACAAGG + Intronic
1152011437 17:77721204-77721226 CTGCACAGTAGCTTAGACCAGGG - Intergenic
1153537590 18:6118781-6118803 CTTACCAGTATTTTAAAACAAGG - Intronic
1156891689 18:42197758-42197780 CTAGAAAATAGTTTAGAACATGG - Intergenic
1158081448 18:53596420-53596442 TTGCACAGTGGTTTAGAGCATGG + Intergenic
1159169896 18:64752440-64752462 CTCCACAGGATTTTAGTACACGG + Intergenic
1164391376 19:27824411-27824433 CTTCACAGTAATATGGATCATGG - Intergenic
1165440233 19:35821999-35822021 CTTCTCAGTATTTTATATCAGGG + Intergenic
1165621982 19:37255720-37255742 CCTAACAGTAGTTTAGAAATTGG + Intergenic
1167344103 19:48934777-48934799 CTTCATAGTAGCTTACATCAAGG - Intronic
928641948 2:33308482-33308504 TTTCACAGTAGGGTAGAATATGG - Intronic
929799175 2:45084869-45084891 ATTCACTGTAGTGTAGTACAGGG - Intergenic
930514331 2:52387047-52387069 CTTCACAATAATTTTGAATATGG - Intergenic
930906427 2:56573768-56573790 CTTCATAGTAGTTAAGGACTGGG - Intergenic
930923693 2:56790194-56790216 GTTAACAGTAGTATAGAAGAAGG + Intergenic
934943251 2:98517775-98517797 CTTGCCAATAGTATAGAACATGG - Intronic
935308839 2:101762665-101762687 CTTCACAGCAATTTAGAATGAGG - Intronic
936349522 2:111702354-111702376 CTTCACAGGAACTGAGAACAAGG + Intergenic
936939093 2:117864634-117864656 GTACACAGTGGTTAAGAACATGG + Intergenic
939293542 2:140225344-140225366 CTTCACAGTCCTTCAGAAAAGGG + Intergenic
939343571 2:140932513-140932535 ATTTAGAATAGTTTAGAACAAGG - Intronic
940316609 2:152334371-152334393 CTTCACAGCAGTCTTGAGCAAGG - Intergenic
942498326 2:176562602-176562624 GGTCACAGTTGATTAGAACAGGG - Intergenic
942895620 2:181050014-181050036 CATCACAGTAATTTACAAAAAGG + Intronic
944195178 2:197045319-197045341 CTTCAGAGCAGTTGAGACCATGG - Intronic
944791524 2:203133966-203133988 CATAACAGCAGTTTATAACATGG - Intronic
946471280 2:219963589-219963611 CTCCACAGTGGCTTATAACAGGG - Intergenic
947679868 2:232020655-232020677 GTTCACAGTAGTTGAGAGCATGG + Intronic
947995978 2:234528302-234528324 TTCCACAGTAGTTTAGACCTTGG + Intergenic
1170545108 20:17429270-17429292 CTTCACAGAACTTTAACACAAGG + Intronic
1172935412 20:38616548-38616570 TTACACAGTGGTTGAGAACATGG + Intronic
1173047510 20:39526654-39526676 CTCCACAGAAGTTTAAAACAAGG - Intergenic
1174470503 20:50756723-50756745 CTTCACAGTGTTTTCAAACAGGG - Intronic
1178112702 21:29384996-29385018 CTTCACTGAAGTGTGGAACAAGG - Intronic
1179267472 21:39817061-39817083 CTTCTCAGTAGTTGGGAGCAAGG - Intergenic
1181825080 22:25508494-25508516 CATCGCAGTGGTTAAGAACATGG - Intergenic
1181919125 22:26306179-26306201 CTTCCCAGAATATTAGAACATGG + Intronic
1181986274 22:26801964-26801986 CTTCAGAGTAGATGAGAAGAAGG + Intergenic
1184049387 22:41992984-41993006 CATCAAAGGAGTTCAGAACATGG + Intronic
949160808 3:879668-879690 CATCACTGTGGCTTAGAACAGGG - Intergenic
949333827 3:2951535-2951557 TTACACAGTAGTCTAGAACAGGG - Intronic
949436526 3:4035564-4035586 ATTCACAGAAGATTAGGACAAGG + Intronic
951219581 3:20055127-20055149 CGTGAGAGTAGTTTAGAACATGG + Intronic
953389766 3:42527400-42527422 CTTCACAGAACCGTAGAACATGG - Exonic
954884817 3:53863570-53863592 CGTTACAGTAGTTTCAAACATGG + Intronic
956879152 3:73492571-73492593 CTTCACAGGAGCTTAGAGAAGGG + Intronic
960650202 3:119939569-119939591 CTAAACAGTATTTTAAAACAGGG - Intronic
962085145 3:132183315-132183337 CTTCACTGTAGTGCAGTACAAGG - Intronic
962303758 3:134267693-134267715 CTTCAGAATGGTTAAGAACATGG - Intergenic
964874553 3:161351405-161351427 GTTCACTGGAGTTTAGAATAGGG - Intronic
967762556 3:193241582-193241604 CTTGCCAGTTGGTTAGAACACGG - Intronic
970816679 4:20164425-20164447 TTTCCCAGAAGTTCAGAACATGG - Intergenic
970870124 4:20807108-20807130 TTTCACAGTTGTTTAAAAAATGG - Intronic
971462322 4:26913912-26913934 CTTCACAGCACTTTATCACAGGG - Intronic
971682512 4:29719035-29719057 ATTCATAGTAGTTTAGAGGAGGG + Intergenic
971885508 4:32441512-32441534 CATCACACTAATTTGGAACAAGG + Intergenic
976534436 4:86194208-86194230 ATTAACAGTAGTTTAGAATTAGG - Intronic
977082985 4:92556757-92556779 CCACAGAGTAGTTTACAACATGG + Intronic
977305811 4:95322449-95322471 CTTTTCTGTAGTTTATAACAAGG - Intronic
977545880 4:98376062-98376084 CTTCACATTAGCTAAGAGCAGGG - Intronic
982420552 4:155191449-155191471 TTTCACATAAGTTTAGAAAAGGG - Intergenic
983977334 4:173951670-173951692 CATCACAGTGGTTCTGAACATGG + Intergenic
984003762 4:174283856-174283878 CTTCACAGGAGTCTTGAACGCGG + Exonic
984138547 4:175973336-175973358 CTTCACAAAGCTTTAGAACACGG + Intronic
985858657 5:2451382-2451404 CTGCACAGGAGTTTAAATCATGG - Intergenic
986351955 5:6888661-6888683 ATACACCGTATTTTAGAACAGGG - Intergenic
987050652 5:14144431-14144453 TTTCACAGAAGTGTAGACCAAGG - Intronic
988414496 5:30928803-30928825 CTTAACAGTAGGGTAGAGCAAGG + Intergenic
990595199 5:57305979-57306001 CTCCACAGTAGCTTGGACCATGG + Intergenic
992589467 5:78278659-78278681 TTACACAGTGGTTTAAAACAGGG + Intronic
992731946 5:79680408-79680430 CATCATAGCACTTTAGAACAGGG - Intronic
993120599 5:83769381-83769403 GCTGACAGTTGTTTAGAACAAGG + Intergenic
995392728 5:111656792-111656814 CTTTACAGCAGTTTAGTAAAAGG - Intergenic
995488123 5:112659445-112659467 CTTCAGATTGGTTAAGAACAGGG - Intergenic
995494159 5:112723886-112723908 CCTCCCAGTAGTTTAGAAGCAGG - Intronic
996040096 5:118799834-118799856 ATATACAGTAGTTTAAAACATGG + Intergenic
998117458 5:139549155-139549177 CCTCTCAGTGGTTTAGAACCAGG - Intronic
999918497 5:156290294-156290316 TAGCACAGTAGTTGAGAACATGG - Intronic
1003318459 6:5032525-5032547 CTACACAGTATCTTAGTACATGG + Intergenic
1004524154 6:16390482-16390504 CTTCTCTCTAGTTTAGAACTTGG + Intronic
1005222987 6:23609364-23609386 TTACACAGGAGTTCAGAACAAGG + Intergenic
1005260691 6:24056232-24056254 CATCACAATAGTTAAGAGCATGG - Intergenic
1005745058 6:28829274-28829296 CTTGACATTATTTCAGAACACGG - Intergenic
1005774523 6:29116294-29116316 CTTCACAGTGGTTTTCATCATGG + Intergenic
1006100731 6:31684555-31684577 CTCCAGAGTAGCTTGGAACACGG + Intergenic
1006670542 6:35727568-35727590 CTTCACAGAAGCCTGGAACACGG - Intronic
1007097079 6:39220013-39220035 CTACACAGTAGTTCAGATGAGGG + Intronic
1007937058 6:45741779-45741801 GTTCACAGTAGGTGAGAAAAAGG + Intergenic
1008438235 6:51501417-51501439 CTTCAAGGTAGATTAGAGCATGG + Intergenic
1008735594 6:54539887-54539909 CTTCACAGTAGTCATGAACCAGG - Intergenic
1009263761 6:61528489-61528511 CTTCTCAGTAGCATTGAACATGG + Intergenic
1011623651 6:89266003-89266025 CTTCACAGTATTTTGGGAAACGG + Intronic
1012902828 6:105027233-105027255 CTGGAGAGTAGTTTAGAACTAGG - Intronic
1014906376 6:127034080-127034102 CTCCACTGTAGACTAGAACATGG + Intergenic
1015224087 6:130836580-130836602 CTACCAAGTACTTTAGAACAAGG + Exonic
1015451349 6:133370415-133370437 TTTCACAGTTTTTTAGTACAAGG + Intronic
1016380272 6:143470484-143470506 CCTCCCAGTAGCTTAGGACAGGG - Intronic
1021292124 7:18858831-18858853 CTTCACAGGAGATCAGGACATGG - Intronic
1021555969 7:21918329-21918351 CCTCACAATAATTTAGAAGAAGG - Intronic
1022983869 7:35630139-35630161 CTTCACAGGAGTTTATAACCAGG + Intergenic
1023194970 7:37625850-37625872 TTGCACAGTAGATTAGCACATGG + Intergenic
1027811578 7:82907976-82907998 CTTCTCAGTTGTTTAAAATATGG + Intronic
1029205082 7:98865033-98865055 CTTCAAACTCGTTTAGAGCAGGG + Intronic
1029940069 7:104470735-104470757 CTTCAGGCTAGTTAAGAACACGG - Intronic
1034068303 7:148157945-148157967 CTTCACAGTTGTTCACTACAAGG + Intronic
1041759634 8:61350445-61350467 CATCACAGTAGTTTATGATAAGG - Intronic
1041795584 8:61744236-61744258 CTGGAAAGTAATTTAGAACATGG - Intergenic
1041797007 8:61755915-61755937 CTTCACAGTTGGTAAAAACAGGG + Intergenic
1045081379 8:98629471-98629493 CTAAACACTACTTTAGAACATGG + Intronic
1045167031 8:99618090-99618112 CTTCCCAGTTGTTTGGAGCATGG - Intronic
1045440466 8:102203606-102203628 CCTCAGAGGAGTTTAGAACTAGG + Intergenic
1046377976 8:113411900-113411922 CAGCACAGTAGTTAAGAATATGG + Intronic
1046541641 8:115591249-115591271 CATTAAAGTTGTTTAGAACATGG + Intronic
1047819285 8:128500932-128500954 TATCACAGTGGTTAAGAACAAGG - Intergenic
1048627757 8:136204656-136204678 CTTTACAGTAGTTGAGATAATGG + Intergenic
1049057238 8:140247028-140247050 CATCACAATAATTTAAAACATGG - Intronic
1049918198 9:338581-338603 CTTCACATTTGTCTCGAACAAGG - Intronic
1050609462 9:7336507-7336529 CTTCACAGTAGTGAAGAGAAAGG + Intergenic
1050898181 9:10910519-10910541 CTTCTCAGTAGGTTTGAAAATGG + Intergenic
1051447263 9:17154081-17154103 CCTTGCATTAGTTTAGAACATGG + Intronic
1052448793 9:28598823-28598845 CTTCACAGTTGTGTAGATGATGG + Intronic
1053036710 9:34832580-34832602 CTTCACAGTGGCAGAGAACATGG + Intergenic
1055633047 9:78244071-78244093 CTACAGAGTTGTTTATAACAGGG - Intronic
1056994813 9:91445838-91445860 CTCCACAGTAGCTTAGCTCAGGG + Intergenic
1057917675 9:99069718-99069740 CTTCACAGTAGTTATCCACAAGG - Exonic
1058159649 9:101554569-101554591 CTTTACAGAATTATAGAACAAGG - Intronic
1187480876 X:19654245-19654267 CTTTCCAGTTTTTTAGAACATGG - Intronic
1187770802 X:22693411-22693433 CTTCACAATATTTAAGTACAAGG - Intergenic
1189533770 X:41915066-41915088 CTGCACAGAAGTTTAAAAGAGGG - Intronic
1189892567 X:45620457-45620479 ATTCACAGCAGTTTAGAATTGGG + Intergenic
1190329820 X:49228927-49228949 CTTCCCAGTGGTTCAGAATACGG - Intronic
1191724465 X:64264684-64264706 CTACACAATTGTTTAGAAAAAGG + Intergenic
1193737197 X:85172709-85172731 ATTAACAGTAGTTTAACACAAGG - Intergenic
1194073255 X:89354206-89354228 TTTCACAATACCTTAGAACAAGG + Intergenic
1195871641 X:109492620-109492642 CTGCATGGTAGTTAAGAACATGG + Intergenic
1197029973 X:121802089-121802111 CTTAGCATTGGTTTAGAACATGG + Intergenic
1198179096 X:134187330-134187352 CTGCACAGAATTTTAGAACCAGG - Intergenic
1199903666 X:152203278-152203300 CTTCAGAGTATTTTAGATAAAGG - Intronic
1200286705 X:154829787-154829809 CAGCAAAGTAGTTTAGAATATGG - Intronic
1200727485 Y:6690009-6690031 TTTCACAATACCTTAGAACAAGG + Intergenic
1200728636 Y:6705784-6705806 TTTCACAATACCTTAGAACAAGG + Intergenic