ID: 1125302473

View in Genome Browser
Species Human (GRCh38)
Location 15:38270637-38270659
Sequence CTCTATCACAAGAACAGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7977
Summary {0: 1, 1: 33, 2: 461, 3: 2326, 4: 5156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125302471_1125302473 24 Left 1125302471 15:38270590-38270612 CCAAGTGGGAAGTGCTACACACT 0: 1
1: 5
2: 14
3: 29
4: 129
Right 1125302473 15:38270637-38270659 CTCTATCACAAGAACAGCGAGGG 0: 1
1: 33
2: 461
3: 2326
4: 5156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125302473 Original CRISPR CTCTATCACAAGAACAGCGA GGG Intronic
Too many off-targets to display for this crispr