ID: 1125305357

View in Genome Browser
Species Human (GRCh38)
Location 15:38306177-38306199
Sequence ATGATTACCTTTGAGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 466}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125305357 Original CRISPR ATGATTACCTTTGAGAAAAA AGG (reversed) Intronic
900230082 1:1552267-1552289 GTGGTTACCTTTGAGAAAAATGG - Intronic
901775486 1:11557760-11557782 ATGTATACCTTTCAGAAAACAGG + Intergenic
901911849 1:12465145-12465167 AAAAATACCTTTGAGAAGAAAGG + Intronic
902843362 1:19089725-19089747 ATGATTACATATGAGACAACAGG + Intronic
902980204 1:20117137-20117159 ATGATAACATTTGAGGAAATTGG - Intronic
903107028 1:21090545-21090567 ATGATTACCATTGATCAAGAAGG - Intronic
903556403 1:24196685-24196707 ATGATTACTTTTGAGAGGGAGGG - Intergenic
903964816 1:27080795-27080817 ATGATTACCCTTAAGAGGAAAGG - Intergenic
904119796 1:28190355-28190377 ATGATTACCTCTGGGAAAGAGGG + Intronic
904603780 1:31687902-31687924 ATGATTGCATTGGAGACAAATGG - Intronic
905608453 1:39326294-39326316 GTGGTTACCTTTGGGAAGAAAGG + Intronic
906762819 1:48392635-48392657 TTAATTATATTTGAGAAAAATGG - Intronic
906978111 1:50597631-50597653 ATAATTATTTTTGTGAAAAAGGG - Intronic
907011092 1:50964079-50964101 ATGGTAACATTAGAGAAAAATGG - Intronic
908080228 1:60569416-60569438 ATAATTACCTTGGTGAGAAATGG - Intergenic
908224300 1:62040468-62040490 ATAATTATCTCTTAGAAAAATGG + Intronic
908653757 1:66365243-66365265 CTGAATAACTTAGAGAAAAATGG - Intronic
909017979 1:70400127-70400149 ATGGCTGCCTTTGGGAAAAAGGG + Intergenic
909139054 1:71840039-71840061 ATAATCACATTTGATAAAAATGG - Intronic
909762640 1:79311558-79311580 AAGATTACCTTGGGGGAAAAAGG - Intergenic
909955922 1:81778693-81778715 ATGATTACCTTTGAAAAATGGGG - Intronic
910943291 1:92560371-92560393 ATGGTTACCTTTGAGTAGAAGGG + Intronic
911214113 1:95173801-95173823 ATGTTTATCATTCAGAAAAATGG + Exonic
911227147 1:95318803-95318825 AAAATTTCCTTTGAAAAAAAAGG - Intergenic
911703367 1:100982192-100982214 AAGAATACCTTTGAGAAGGAAGG - Intergenic
916304376 1:163312643-163312665 ATGATTAGGTTAGATAAAAAAGG + Intronic
916931687 1:169585175-169585197 ATGATTATTTTTGAGAAGGAGGG + Intronic
918111073 1:181455983-181456005 ATGGTTACCATTGACTAAAATGG + Intronic
918845015 1:189598184-189598206 ATTTTTTTCTTTGAGAAAAAAGG + Intergenic
918877022 1:190060821-190060843 ATGAGTAGCTTAGAGAACAAAGG - Intergenic
919401099 1:197118325-197118347 ATGATTAACTTTTAGGAAAGGGG + Intronic
919679026 1:200415684-200415706 ATTCTTCCCTTTGAGAAAATAGG - Intergenic
920082179 1:203382817-203382839 TTGATTTCCTTGGAGAAAGATGG - Intergenic
920978675 1:210810718-210810740 TTGATATCCTTTGAGAAAATAGG - Intronic
921470786 1:215546436-215546458 ATCAATAGGTTTGAGAAAAAGGG - Intergenic
921757696 1:218879332-218879354 AAAAATACCTTAGAGAAAAAGGG - Intergenic
923005557 1:230046629-230046651 ATAATTTCCTTTGAGACAACTGG + Intergenic
923125839 1:231033669-231033691 ATGCTTACCTTTAAACAAAAGGG + Intronic
924373603 1:243383046-243383068 ATGAATACCTTTATGTAAAAGGG - Intronic
924631830 1:245748041-245748063 TTGAGTAGCCTTGAGAAAAAGGG - Intergenic
1062775197 10:138720-138742 ATTATTACCTTTCAGCAAAGAGG + Intronic
1062957014 10:1547148-1547170 ATCATTACCTTTGGGGAAACTGG + Intronic
1066313306 10:34219191-34219213 ATGATTGCCCTTGAAAAAAGAGG - Intronic
1066698161 10:38096653-38096675 ATAATTACTTTTAAGCAAAACGG - Intronic
1067406553 10:46029155-46029177 ATTATTACCTTTGTGCAAACAGG - Intronic
1067712503 10:48661166-48661188 AAGATTACCTGGGAGAGAAAAGG - Intergenic
1067931249 10:50564239-50564261 GTGCTTACCTTTGAGGGAAAGGG + Intronic
1067949761 10:50722063-50722085 ATGCTTACCTTTGGGAAGACAGG + Intergenic
1068224490 10:54089447-54089469 ATGATAACTATTGAGAAAACTGG - Intronic
1069250181 10:66257314-66257336 ATCAATACCTGTGAGAAAAATGG - Intronic
1070036107 10:72725985-72726007 ATGGTTATCTTGGAGCAAAATGG - Intronic
1070690910 10:78524689-78524711 ATTATTTTCTTTGAGAACAAAGG - Intergenic
1070885068 10:79887096-79887118 ATGCTTACCTTTGGGAAGACAGG + Intergenic
1072649810 10:97286245-97286267 ATGTGTTCCTTCGAGAAAAATGG - Intronic
1073091023 10:100939737-100939759 ATCAATACCTATTAGAAAAATGG + Intronic
1073647833 10:105324463-105324485 CTGATTAACCTTGAGATAAAAGG - Intergenic
1073926361 10:108520904-108520926 ATGATTCCTTTTTAAAAAAAAGG - Intergenic
1073952530 10:108827612-108827634 ATGATTACATTAAATAAAAATGG + Intergenic
1075624844 10:123955049-123955071 TTGATTATCTTTGGTAAAAATGG - Intergenic
1077734720 11:4777625-4777647 GTGATCACCTTTGAGGAGAAAGG - Intronic
1078593427 11:12665743-12665765 AGAATTACCTTTGAGAAGGAGGG + Intergenic
1079260001 11:18869365-18869387 ATGATTCCCTTTTAAATAAATGG + Intergenic
1079552012 11:21711463-21711485 ATGAGTAACTTTTAGAAAAGTGG - Intergenic
1079734369 11:23977145-23977167 ATGAATTCCTTTGAGAATTAGGG - Intergenic
1080881939 11:36329543-36329565 TTGATTATCTTTGAGCAAAATGG - Intronic
1081268324 11:41055106-41055128 ATGATAACCTCTGAGGAAAAGGG - Intronic
1082023149 11:47552122-47552144 TTTATTACCTTCGAGTAAAAAGG - Intronic
1082065943 11:47900320-47900342 ATGAATACCCTTGAGCAGAAAGG - Intergenic
1085104627 11:73831455-73831477 ATGAGCACCATAGAGAAAAAAGG - Intronic
1085166401 11:74404218-74404240 ATGATTATCTTTGTGAAAGGGGG + Intergenic
1085826119 11:79849495-79849517 ATGTTTACCTTAAAGAAAAAAGG + Intergenic
1086532554 11:87802941-87802963 ATATTTAACTTTAAGAAAAACGG - Intergenic
1086742141 11:90380845-90380867 ATGATTGCCTGTGAAAATAATGG - Intergenic
1086801522 11:91182838-91182860 ATGAAAACCTCTGAGAAACATGG - Intergenic
1087584753 11:100104693-100104715 GTGTTTTCCTTTGAGGAAAATGG + Intronic
1088475486 11:110234086-110234108 TGGAGTACTTTTGAGAAAAAGGG - Intronic
1090102851 11:123819301-123819323 ATAATTTCCAATGAGAAAAAAGG - Intergenic
1090126753 11:124094139-124094161 ATGTTTTCCTTTGAGATACACGG - Intergenic
1090641225 11:128730573-128730595 AGGCTTCCCTTTGAGAACAAAGG + Intronic
1091387250 12:103244-103266 ATTATCACCCTTGAGACAAATGG - Intronic
1091658774 12:2365420-2365442 ATGATTTCTTTTGAAAAATATGG + Intronic
1092653920 12:10664872-10664894 ATGATTTCCTATTACAAAAATGG - Intronic
1092871278 12:12807974-12807996 ATGAAAACCTTTGAGTAAGATGG + Intronic
1093494086 12:19735560-19735582 AACATTCCCTTTGAGTAAAAGGG + Intergenic
1093624918 12:21334122-21334144 ATAATTTCCTGTAAGAAAAATGG - Intronic
1093648829 12:21619906-21619928 ATTATTAACTTTCCGAAAAATGG - Intergenic
1093721106 12:22443281-22443303 ATGATTCCCTTTGGGGAATAAGG + Intergenic
1094412078 12:30177223-30177245 ATGATCACCTTTTAAATAAATGG + Intergenic
1095477210 12:42597544-42597566 ATTAGTAGCTTTGAGCAAAAAGG - Intergenic
1095495770 12:42782051-42782073 AGGCTTATCTTTTAGAAAAATGG - Intergenic
1095512455 12:42967267-42967289 ATGATGACCTGTGACAAAATGGG - Intergenic
1095615943 12:44188631-44188653 AAGATGACATTTGAGCAAAATGG - Intronic
1096930897 12:55208876-55208898 ATCATTCCCTTTTAGCAAAATGG - Intergenic
1097035226 12:56119485-56119507 ATTGTTCCCTTTGAGAATAAGGG - Intronic
1097540974 12:60942503-60942525 ATGATTTCTTTTGAAATAAAAGG - Intergenic
1097931280 12:65189661-65189683 GTGATTATCTTTGATAGAAATGG - Intronic
1098455121 12:70664304-70664326 ATGATTACCTTTAACAAAGTGGG - Intronic
1098564184 12:71912838-71912860 ATGATAACGTTTAAGTAAAAAGG + Intronic
1098616366 12:72529434-72529456 ATGATTACCTCTGGGAATAGAGG - Intronic
1098739834 12:74158874-74158896 ATAATTATCTTTGAAAAAAGTGG + Intergenic
1098746894 12:74249343-74249365 ATGTGTACATTTGAAAAAAATGG + Intergenic
1099148919 12:79083752-79083774 ATGATTGCATTTGAGAAGGAAGG + Intronic
1099149511 12:79091822-79091844 GTGATTAACTTTGGTAAAAAGGG - Intronic
1099504491 12:83455966-83455988 ATTATTTTCTTTGAGAGAAAGGG + Intergenic
1099823520 12:87746114-87746136 ATGACTAGATTTGAGAAGAATGG + Intergenic
1099964908 12:89435714-89435736 ATAATTACCATGGGGAAAAATGG + Intronic
1100044052 12:90356949-90356971 ATGACTAGCTTTGGGAAAAGGGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101860478 12:108478439-108478461 GTGTTTCCCTCTGAGAAAAAAGG - Intergenic
1102123546 12:110462220-110462242 ATGCTTTTCTTTGAGAAAAAAGG - Intronic
1102266120 12:111487054-111487076 TTGATTGCCTTTGAGAGGAACGG - Intronic
1104397445 12:128446502-128446524 TTAAATGCCTTTGAGAAAAAGGG - Intronic
1105171628 13:17600283-17600305 TTGATTCCTTTTGTGAAAAAGGG + Intergenic
1105182009 13:17761420-17761442 TTGATTCCTTTTGTGAAAAAGGG + Intergenic
1105183612 13:17786734-17786756 TTGATTCCTTTTGTGAAAAAGGG + Intergenic
1105192592 13:17926276-17926298 TTGATTCCTTTTGTGAAAAAGGG + Intergenic
1105724188 13:23144809-23144831 ATTATGAAATTTGAGAAAAAGGG + Intergenic
1106045369 13:26134814-26134836 ATAATTACCATTGGGAATAAAGG + Intronic
1106415838 13:29545063-29545085 ATGATTACCTGAGACAAAAGTGG - Intronic
1106807634 13:33327076-33327098 TTAATTTCCCTTGAGAAAAATGG + Intronic
1107094815 13:36525055-36525077 ACCAAAACCTTTGAGAAAAATGG + Intergenic
1108669264 13:52667048-52667070 ATGATAACTTTTGAGTATAAGGG + Intronic
1109103089 13:58211440-58211462 ATGATTACATTTCAAAGAAATGG + Intergenic
1109234476 13:59798278-59798300 ATGATTTGCTTTTAGAGAAATGG - Intronic
1109410418 13:61958409-61958431 ATGATTATCTTACAGAAAGAGGG + Intergenic
1109524060 13:63552368-63552390 ATGTTTACCTTTCACAAGAAAGG + Intergenic
1109552656 13:63924490-63924512 ATGATTAGCTTTTAAAAAATTGG - Intergenic
1109736438 13:66490824-66490846 ACTTTTACCTATGAGAAAAAAGG - Intronic
1110068300 13:71138487-71138509 AAAATTACCTGTGAGATAAAAGG + Intergenic
1110752192 13:79127785-79127807 ATGGTTACCTCTGAGAAGAAGGG + Intergenic
1111134921 13:84028568-84028590 ATGGTTAGGTTTGATAAAAATGG - Intergenic
1111289184 13:86140953-86140975 ATGTTTCCCTGTGAGAAACATGG + Intergenic
1111413538 13:87909705-87909727 ATGATGTCCTTAAAGAAAAAGGG + Intergenic
1111506669 13:89198733-89198755 GTCATTACCTTTGACAAACATGG + Intergenic
1111540587 13:89662770-89662792 ATGATTATCTTTGGTAAACATGG - Intergenic
1114301986 14:21386483-21386505 ATGCTTACCTTTGTTAAGAAGGG + Intronic
1114957112 14:27836341-27836363 ATCAATACCTTACAGAAAAAGGG + Intergenic
1115166327 14:30452391-30452413 ATGACTGGCTTTGGGAAAAAGGG + Intergenic
1115725599 14:36212857-36212879 ATAGTTACCTTTGAAATAAAAGG + Intergenic
1116200135 14:41783070-41783092 ATCATTTCCTTTGACAAATAGGG + Intronic
1116673922 14:47880277-47880299 ATGATTTCATTTGGAAAAAAAGG + Intergenic
1117613792 14:57511691-57511713 AGGATGACATTTGAGAGAAATGG - Intergenic
1117870009 14:60190461-60190483 ATGATTACATTTCAGAGAAGAGG - Intergenic
1118082951 14:62382637-62382659 ATGTCTACCTTTGGGAAAAGTGG - Intergenic
1118513780 14:66505479-66505501 ATGAATACACTTAAGAAAAACGG + Intergenic
1118586393 14:67357894-67357916 ATGATTACGTTTCAAAGAAATGG + Intronic
1118993351 14:70815687-70815709 ATGGTTACCAGTTAGAAAAAAGG + Intergenic
1119090405 14:71775589-71775611 ATTCTTACCTTTCAGACAAATGG + Intergenic
1120020533 14:79525101-79525123 ATGACTAGCTTTGAGGAAGAGGG + Intronic
1120082641 14:80233086-80233108 ATCATAACCTTTAAGAGAAATGG + Intronic
1122351510 14:101096482-101096504 GTAATTACCTTTGGTAAAAATGG + Intergenic
1123973678 15:25532369-25532391 ATGATTACCTTAGGGAAATTAGG - Intergenic
1125299588 15:38240503-38240525 GTGGTCACCTTTGAGAAAAGTGG + Intergenic
1125305357 15:38306177-38306199 ATGATTACCTTTGAGAAAAAAGG - Intronic
1125320423 15:38481721-38481743 ATGATTACTTTTTAGAAAGATGG - Intronic
1125707905 15:41757043-41757065 ATGGTTACTTTTGAGAAGGAAGG + Intronic
1126031309 15:44501195-44501217 GTGATTGCATTTGAAAAAAATGG + Intronic
1126217343 15:46171505-46171527 ATGACTACATTTCAGAAGAATGG + Intergenic
1126485605 15:49176801-49176823 ATGCTTACATTTGACAAGAATGG - Intronic
1126620071 15:50629623-50629645 ATGACTACCTCTTAGAAAAATGG - Intronic
1126628208 15:50706563-50706585 ATCATTACCTATGGGAAAAGGGG + Exonic
1128482403 15:68050882-68050904 ATGATTATCTTTGGTAGAAATGG + Intergenic
1129136960 15:73562502-73562524 ATGATTACCTTTTATCAAGAAGG - Intronic
1129736490 15:77968521-77968543 GGGATTACCTTTGGGAAAACTGG - Intergenic
1129849594 15:78785143-78785165 GGGATTACCTTTGGGAAAACTGG + Intronic
1130252671 15:82310538-82310560 GAGATTACCTTTGGGAAAACTGG - Intergenic
1131767603 15:95696866-95696888 ATGACTACTTTGGAGAAACATGG + Intergenic
1131768458 15:95706877-95706899 CTGATTACCTTAGAGAATAATGG + Intergenic
1131810292 15:96166429-96166451 AGGATTACCATTTAGAAAATTGG + Intergenic
1132436668 15:101810979-101811001 ATGACTGTCTTTGAGAGAAAGGG + Intronic
1135714463 16:24749710-24749732 GTTATTACCTTTCAGGAAAAAGG - Intronic
1135734741 16:24921662-24921684 AGGAGTAACTGTGAGAAAAAGGG - Intronic
1137891559 16:52168298-52168320 ATGGTCACCTCTGAAAAAAAGGG + Intergenic
1140412390 16:74748886-74748908 ACCATTCCCTTTCAGAAAAAGGG - Intronic
1140424114 16:74846110-74846132 TTGTTTCCCTTTGAGAAAAGGGG - Intergenic
1140548511 16:75836532-75836554 ATGATTACATTTCAGACGAATGG - Intergenic
1140627262 16:76809167-76809189 GTGATTACCTTTTAAAAATAAGG + Intergenic
1140969717 16:80001374-80001396 CTCATTACATTTGAGAAAATGGG + Intergenic
1146624663 17:34426163-34426185 TTGAATACCTTTGAGAATGAAGG - Intergenic
1147822097 17:43247599-43247621 ATGATTACCTTGGGGAAACCAGG + Intergenic
1148136438 17:45295253-45295275 ATGATTTCATTTGACAAAAATGG - Intronic
1149134219 17:53345386-53345408 ATGATTATCTTTCATAAGAATGG + Intergenic
1149221270 17:54417792-54417814 ATTATGACTTTTGAAAAAAATGG + Intergenic
1149854181 17:60065113-60065135 ATGAGAACCTAGGAGAAAAATGG - Intronic
1149864563 17:60143653-60143675 ATGATTGCCTCTGGGAAATAAGG + Intergenic
1150086825 17:62277970-62277992 ATAGTTACCTTTGTGAAGAAGGG - Intronic
1150823541 17:68455795-68455817 ATCATTAGATTTGACAAAAAAGG - Intronic
1150950331 17:69796742-69796764 GTGATTATCTTTGAGAAATCTGG - Intergenic
1153397444 18:4640686-4640708 TTGATTACCTTTAATTAAAATGG - Intergenic
1153819082 18:8817453-8817475 ATCTTTACCTTTGAGAAAGATGG - Intronic
1153899710 18:9606927-9606949 TGGATTACCTGTGGGAAAAAAGG - Intronic
1154169665 18:12042014-12042036 TTGATTATCTTTGATAAAAATGG - Intergenic
1155348537 18:24883343-24883365 AAAATTGCTTTTGAGAAAAATGG - Intergenic
1155452908 18:25981581-25981603 ATGTTTTGCTTTAAGAAAAAGGG + Intergenic
1155587321 18:27381770-27381792 AGGATTACCTAAGAGAAACAAGG - Intergenic
1156321209 18:36025047-36025069 GTGATTACCTCTGAGAAGAGAGG + Intronic
1156803583 18:41148837-41148859 ATGATTAGCAGTGAGCAAAATGG + Intergenic
1158523558 18:58192424-58192446 ATCTTAACCTTTGAGAAAATAGG - Intronic
1158743828 18:60174242-60174264 ATAATTTCTTTAGAGAAAAATGG - Intergenic
1159695892 18:71555367-71555389 ATCATTTCCTTTGAGACAAAAGG - Intergenic
1159775081 18:72595144-72595166 ATAAGCACCTATGAGAAAAAAGG - Intronic
1159813077 18:73040354-73040376 ATGATTACATTTTACAAGAATGG - Intergenic
1159978436 18:74745502-74745524 ATGATTACATTTTATAAAGAAGG - Intronic
1160101848 18:75927883-75927905 ATGATTAACTGTGAGAATGATGG + Intergenic
1160117001 18:76088438-76088460 ATGTTAACCTTTGAGAAATCTGG + Intergenic
1160290738 18:77590807-77590829 ATGACTGGCTTTGAGAAAAGAGG - Intergenic
1161178259 19:2861239-2861261 AGGATTACCATTTAGAAAATAGG - Intergenic
1166418243 19:42611728-42611750 AAGACTACCTCTGGGAAAAAAGG - Intronic
1167030430 19:46955783-46955805 ATGATTTCCTTTTTAAAAAATGG + Intronic
925817119 2:7764379-7764401 TTGATTGGCTTTGACAAAAATGG - Intergenic
925976764 2:9147111-9147133 ATTATTGCCTTTGGGAAGAAGGG - Intergenic
926839872 2:17068093-17068115 ATGATTACGTTTGAGACTACGGG - Intergenic
927386306 2:22537829-22537851 ATGTTTGCCTTTGAGAAAATGGG - Intergenic
927825698 2:26308727-26308749 ATGAATATATTTGATAAAAATGG - Intronic
929301873 2:40313459-40313481 ATGTTTAACTTTTAAAAAAACGG + Intronic
929591193 2:43147649-43147671 ATGATTTCTTTTGTGAAAAAAGG - Intergenic
930050695 2:47213839-47213861 ATGTTTAATTTTGTGAAAAATGG - Intergenic
931222256 2:60298199-60298221 ATGAGTATCTTAGAGAAGAAAGG - Intergenic
931327905 2:61246973-61246995 ATGGTTTCCTTTTAAAAAAAAGG + Intronic
931413305 2:62056032-62056054 ATGATTACATATCAGGAAAACGG + Intronic
931492674 2:62766409-62766431 ATGTTTCTCTTTGAGAAACATGG + Intronic
931502442 2:62884156-62884178 GTGATTACATCTGAGAAGAAAGG + Intronic
935587232 2:104812425-104812447 GTGGTTACCTTTGAGGGAAAGGG + Intergenic
936653146 2:114453302-114453324 TTGATCACGTTTGAGCAAAAGGG + Intronic
937637891 2:124177220-124177242 ATGGTTGGCTTTGGGAAAAAGGG + Intronic
938277477 2:130038675-130038697 TTGATGTCCTTTGAGAAATAAGG + Intergenic
938437906 2:131298705-131298727 TTGATGTCCTTTGAGAAATAAGG - Intronic
938761234 2:134428084-134428106 AAGATTATCTGGGAGAAAAAAGG - Intronic
939160873 2:138587195-138587217 ATGTTTCCCTAGGAGAAAAATGG + Intergenic
939261288 2:139813401-139813423 ATAATTAGCTTTGTTAAAAATGG + Intergenic
939392586 2:141587701-141587723 ATAATTACCTTTGAGATTAATGG + Intronic
939607625 2:144271949-144271971 GTGGTTACCTTTGGGAAAGAAGG - Intronic
939721637 2:145659709-145659731 ATGATTAACATTGAGTTAAATGG + Intergenic
940100593 2:150034166-150034188 ATAATTAGCTTTCACAAAAAAGG - Intergenic
940935596 2:159490874-159490896 ATGGAGACCTCTGAGAAAAATGG - Intronic
941249722 2:163147218-163147240 ATGATTTTCTTTAACAAAAATGG + Intergenic
941544158 2:166826537-166826559 ATGAGTTCCTAGGAGAAAAAAGG - Intergenic
941953528 2:171180949-171180971 ATGATTAACTCTGATAATAATGG + Intronic
942176266 2:173337439-173337461 AAGATTACTTTTGATCAAAAGGG + Intergenic
943344823 2:186725922-186725944 TTGATTTCCATTGAGGAAAATGG + Intronic
943522778 2:188974490-188974512 ATGATGAGCTTTGTGCAAAAGGG + Exonic
943896054 2:193361488-193361510 TTGACTACCTTTGTGAACAATGG + Intergenic
944139655 2:196441708-196441730 ATGATTATCTATGATAAACACGG - Intronic
944541964 2:200762644-200762666 ATGATTACCCTTGACCAAGAGGG - Intergenic
945295235 2:208163803-208163825 ATTATGACCTTGGAGACAAAGGG + Intergenic
945354977 2:208829689-208829711 ATGACTAGCTTTGGGGAAAAGGG - Intronic
945377409 2:209095468-209095490 AGGAATATCTTTGAGATAAAAGG - Intergenic
945436296 2:209821945-209821967 ATGATAACATGTAAGAAAAATGG - Intronic
945448137 2:209962255-209962277 ATGACTTGCTTTGAGGAAAAGGG + Intronic
945595608 2:211786874-211786896 AAAATTACATGTGAGAAAAATGG - Intronic
946908760 2:224441054-224441076 ATTAATGCCTTAGAGAAAAATGG - Intergenic
948800619 2:240431845-240431867 ATGACCTCCTTTGAGAATAATGG + Intergenic
1170057482 20:12222644-12222666 ATGATCACATTTGAAAGAAATGG + Intergenic
1172747067 20:37219253-37219275 ATTATTACCTATCAGAGAAATGG - Intronic
1172825130 20:37776072-37776094 ATGTTTCACTTTAAGAAAAATGG - Intronic
1175118853 20:56703028-56703050 ATGAATACCTGTGTGACAAAGGG + Intergenic
1175464126 20:59178402-59178424 ATTATCACATTTGAGAAAAAGGG - Intergenic
1175588347 20:60165652-60165674 ATGATGAATTTGGAGAAAAAAGG - Intergenic
1177528006 21:22322203-22322225 ATGATTACCTTTGACTGTAATGG - Intergenic
1178552838 21:33556057-33556079 ATGATTACCTATAATAAATATGG + Intronic
1178832228 21:36065578-36065600 ATGATTACATTTCAGAGGAATGG - Intronic
1181144125 22:20831990-20832012 ATGAACACCTCTGAGAAATATGG - Intronic
1182400569 22:30073458-30073480 ATGTTTACCTTTTTGAGAAATGG - Intergenic
1183167697 22:36160188-36160210 AGGATTTCCTTTGAGATACAAGG - Intronic
1183656846 22:39190819-39190841 TTGATTAGCTTTGAGTAAAAAGG + Intergenic
1184051569 22:42009536-42009558 ATGATGTCCTTTTAGAAAACTGG - Intronic
1185200919 22:49504262-49504284 ATGATTACCTGAGAGACAGAGGG + Intronic
949207506 3:1457713-1457735 TTGACTTCCTTTGAGAAAATAGG - Intergenic
949575353 3:5333333-5333355 ATGATTCCCTATGAGACAATGGG + Intergenic
949707724 3:6838178-6838200 TTGATTATCTTTGATAGAAATGG - Intronic
950916357 3:16649886-16649908 GTGATTGCCTTTGGTAAAAATGG + Intronic
951787012 3:26432903-26432925 AAGATTAGCTTTGAGAGACAAGG + Intergenic
951840746 3:27031493-27031515 AAGATTCCCTTCGAGAAACAAGG + Intergenic
952705261 3:36370836-36370858 ATGATTATCTTTGGGGAAGAGGG - Intergenic
952711757 3:36438894-36438916 ATGCTTTCCTTTGATAAACAGGG + Intronic
955108147 3:55920120-55920142 AGGATTCTCTTTGAGAAAAATGG + Intronic
955714978 3:61820014-61820036 AAGAATACATTGGAGAAAAAGGG + Intronic
955971669 3:64443917-64443939 ATGATTACGTTTGGGAGACAAGG - Intronic
956084344 3:65594240-65594262 GTGATTCCATTTGATAAAAATGG - Intronic
956147719 3:66208356-66208378 ATGATTTCCTTTAAAAAAAAAGG - Intronic
956370906 3:68559847-68559869 ATGGTTAAGTTTGAGGAAAATGG - Intergenic
956450200 3:69366713-69366735 ATGAATACTATTGAAAAAAAAGG - Intronic
957226204 3:77451091-77451113 CTGATTCCCTTTGAGAATTAAGG - Intronic
957261795 3:77911148-77911170 ATGATTACCTTTGGGGAACTCGG + Intergenic
957468101 3:80621726-80621748 ATGATTTCCTTTAAAAAATAAGG - Intergenic
957527596 3:81397156-81397178 ATTGTTACCTTTGCAAAAAAAGG + Intergenic
957541395 3:81574534-81574556 ATGAATACTTTTTAGAGAAAAGG - Intronic
958094027 3:88918149-88918171 ACCATTATCTTAGAGAAAAATGG + Intergenic
958139544 3:89543637-89543659 TTGATTACCTTTTATGAAAAAGG + Intergenic
958187568 3:90142602-90142624 ATTATTAACTTTGGGAAAATAGG - Intergenic
958259575 3:91364686-91364708 GTGATTACCTTTGAAGAGAAAGG + Intergenic
958463681 3:94431279-94431301 ATGATAATCTTTGAAGAAAAGGG + Intergenic
958746048 3:98136175-98136197 ATAATTACATTTGAAAGAAATGG - Intergenic
958959588 3:100496180-100496202 ATGATTATCTGAGAGAAAAAGGG - Intronic
959182139 3:102994761-102994783 ATATTTACCTTTGAGATTAATGG + Intergenic
959422189 3:106142667-106142689 ATGTTTAAGGTTGAGAAAAAGGG - Intergenic
959661544 3:108874101-108874123 ATGTTTACCTCTGAGAGAGAGGG + Intergenic
959882690 3:111463604-111463626 CTAATGACCTTTGAGAAAGATGG - Intronic
961088064 3:124086777-124086799 ATGGTTACCTATGGGAAAAGTGG - Intronic
964133013 3:153312443-153312465 ATGATTACTTTTGAAAATGATGG + Intergenic
964511971 3:157462811-157462833 TTGATCACCTTTAAGACAAAAGG - Intronic
964579921 3:158222238-158222260 ATGGTTACATGTGAAAAAAATGG - Intronic
964655775 3:159064562-159064584 ATGATTCCCTTTGATTTAAAAGG - Intronic
965365816 3:167798522-167798544 ATTTTTACCTTTGCTAAAAATGG - Intronic
965415663 3:168389181-168389203 ATGAATAGCTTTGGGAAAAGGGG - Intergenic
965482661 3:169239203-169239225 TTGATTACCTTTAAGAAAAAAGG - Intronic
965570907 3:170172029-170172051 ATGATTGGATTTTAGAAAAATGG + Intronic
965948166 3:174268187-174268209 ATGATTTCCTTTGATTCAAAAGG + Intronic
966431600 3:179836975-179836997 TTGATTATCTTTGACAGAAATGG + Intronic
967353902 3:188546426-188546448 ATCATTACCTTTGAGAGAGGTGG + Intronic
967384678 3:188899759-188899781 ATGATTACCTTTCAAAGGAATGG - Intergenic
968167948 3:196483515-196483537 ATGGTTCACTTTGAGAAAACTGG + Intronic
969384437 4:6834633-6834655 ATTATTACCTTTGACACAATTGG + Intronic
970550168 4:17172185-17172207 ATGATAACCTTTAATGAAAAAGG - Intergenic
970914122 4:21312391-21312413 ATTAGAACTTTTGAGAAAAATGG - Intronic
971691252 4:29839682-29839704 ATTATTACATGTGAGAAAGAGGG + Intergenic
971691268 4:29839833-29839855 ATTATTACATGTGAGAAAGAGGG + Intergenic
971886134 4:32450603-32450625 ATCAATACCTTTGAGGAAGATGG - Intergenic
972195140 4:36645385-36645407 ATGGTTGACTTTGGGAAAAAGGG - Intergenic
972217722 4:36916027-36916049 ATGATTACATTTCAGAGGAATGG + Intergenic
972591925 4:40496077-40496099 CTGCTTTCCTCTGAGAAAAAAGG + Intronic
972635494 4:40880368-40880390 ATGATGACATTTGAGTAAAAAGG + Intronic
972752181 4:42001294-42001316 ATAATTACTTTTCAGAATAAAGG - Intronic
974268610 4:59619324-59619346 ATCATAACCTTAGAGAAATATGG + Intergenic
974653392 4:64785245-64785267 ATGTTTACATTTTAGGAAAATGG + Intergenic
975656295 4:76644204-76644226 ATGATCACCTTTTGGAAAAAAGG - Intronic
976008476 4:80458985-80459007 ATGAATATCTTTTAGAGAAAGGG + Intronic
976087081 4:81417749-81417771 ATGACTAGCTTTGGGGAAAAGGG - Intergenic
976459358 4:85290434-85290456 AGCATTTCCTTTGAGCAAAATGG - Intergenic
977758926 4:100707081-100707103 ATGATTAGGCTTGAGTAAAATGG + Intronic
977759005 4:100708213-100708235 AAGATAACTTTTGAGAAAATGGG + Intronic
977893806 4:102342566-102342588 ATAATTACCTTGGAAAGAAAAGG - Intronic
979024427 4:115550569-115550591 ATAATTACCTTTGTTAAAATTGG - Intergenic
979371409 4:119892107-119892129 ATGAATACTTTTGAGTAAAAAGG + Intergenic
979633174 4:122926141-122926163 ATGATTACCATTGAAAGACAAGG + Intronic
979838477 4:125405235-125405257 ATCATGACCATTGTGAAAAAAGG + Intronic
980521682 4:133944633-133944655 ACTATTACCTTTGAGGAAAATGG + Intergenic
980661285 4:135862334-135862356 AAGATTTCCTTTAAGTAAAATGG + Intergenic
982141771 4:152328407-152328429 ATGATTACTTTTGGGTAGAAAGG + Intronic
982159241 4:152551129-152551151 ATGGTTACTTCTGGGAAAAAAGG - Intergenic
982447259 4:155507397-155507419 TTGATTACCTCTGAGAGAAATGG + Intergenic
982516018 4:156350733-156350755 AGGATAAGCTTAGAGAAAAAGGG + Intergenic
982598147 4:157412114-157412136 ATGTGTTCCTTTGATAAAAATGG + Intergenic
983124311 4:163931517-163931539 ATGGTTGTCTTTGAGAAAATGGG + Intronic
983808740 4:172030296-172030318 AACATTACCTTTAAGAAAATAGG - Intronic
983935068 4:173496801-173496823 ATGATTACATTTATGAAGAATGG + Intergenic
984405396 4:179323120-179323142 AAGATTGCCTTTAAGAAAATAGG + Intergenic
984421189 4:179524249-179524271 AAGATTAACTCTGAGAAAATAGG + Intergenic
986157231 5:5188513-5188535 ATGATTAGCTTGGGGAAAAATGG - Intronic
986481905 5:8198156-8198178 ATAATTACCTGCTAGAAAAATGG + Intergenic
986619634 5:9659134-9659156 TTGATAACCTCTGAGAAAATGGG + Intronic
986886064 5:12238008-12238030 ATGATTACCTTTCAAAAGCATGG + Intergenic
987281258 5:16415912-16415934 ATGATTCCCTTACAGGAAAAGGG + Intergenic
988262224 5:28902574-28902596 ATTATTAACATTGAGAAGAAAGG + Intergenic
989081303 5:37624999-37625021 ATGACTAGCTTTGAGGAATAGGG + Intronic
989652265 5:43705407-43705429 TTGATGACATTTGAGAGAAATGG + Exonic
989687464 5:44107237-44107259 AAGATAACTTTAGAGAAAAAAGG - Intergenic
990055071 5:51564737-51564759 ACTATTACCTTTGAGAAAGAAGG - Intergenic
990405485 5:55486247-55486269 ATGACTACCTCAAAGAAAAATGG - Intronic
990626190 5:57613882-57613904 ATAAATATCTTAGAGAAAAAAGG - Intergenic
990721963 5:58706857-58706879 ATTTTTACCGTTGAGACAAAGGG + Intronic
990861781 5:60335438-60335460 ATGGTTACTTTTTAGAAGAATGG + Intronic
991513137 5:67402570-67402592 ATGGTTACCTCTGAGAATTAAGG + Intergenic
991724614 5:69523837-69523859 ATGATTACCTTTTTAAAAACTGG + Intronic
992278894 5:75152473-75152495 ATTATTACCTTTAACAACAAAGG - Intronic
992340941 5:75822940-75822962 ATGATAACCCATGATAAAAAGGG + Intergenic
993698183 5:91086882-91086904 ATAATTACTTTACAGAAAAATGG - Intronic
993712322 5:91238146-91238168 ATGATTATCTTTAATAAAAATGG - Intergenic
993822666 5:92638912-92638934 ATGTTTACCTGTGATACAAAAGG - Intergenic
994427216 5:99606275-99606297 ATTATTCCCTTTGACAGAAAAGG + Intergenic
994756410 5:103798875-103798897 ATGGATGACTTTGAGAAAAATGG - Intergenic
995197687 5:109391698-109391720 ATGATTATATATGAAAAAAAAGG + Intronic
995414741 5:111896546-111896568 TTGATTACCTTTGTGAACATAGG - Intronic
995447210 5:112258623-112258645 ATGTGTGTCTTTGAGAAAAATGG - Intronic
996625149 5:125562136-125562158 ATGATAATCTCTGAGAACAAGGG - Intergenic
996822584 5:127647284-127647306 ATAATTATCTTTAAGAAGAAAGG + Intergenic
997065880 5:130557960-130557982 ATTATCACCTCTGAGAAATATGG + Intergenic
997204932 5:132042335-132042357 AAGAAAACCTTTGAGAAATATGG - Intergenic
997900448 5:137758923-137758945 TTGATTACATATCAGAAAAACGG - Intergenic
998007950 5:138669831-138669853 ATGGTGTCCTTTGAGAACAAAGG - Intronic
998773985 5:145578230-145578252 ATGAGTACCTGTGAGGAAACAGG + Intronic
998819325 5:146044005-146044027 ATGATTAACTTTATAAAAAATGG + Intronic
999796924 5:154997458-154997480 AATCTTAACTTTGAGAAAAATGG + Intergenic
999959022 5:156734550-156734572 ATGAAAACCTCTGAGAAATATGG - Intronic
1000422417 5:161053863-161053885 ATAATTATCTTTGAGAGAAGGGG - Intergenic
1000570488 5:162906991-162907013 ATGATTATTTTTGAGATAAGTGG - Intergenic
1000831313 5:166104164-166104186 ATGATTACCTATAAGATAAAAGG - Intergenic
1000845323 5:166272677-166272699 ATTAATACCTTTGTAAAAAACGG - Intergenic
1003301788 6:4890467-4890489 ATTATTGCTTCTGAGAAAAAAGG - Intronic
1003779162 6:9403826-9403848 ATGATTTGGTTTGAGAAAACAGG - Intergenic
1005008172 6:21310988-21311010 ACGATGACCTTTGAGCTAAAAGG - Intergenic
1006687179 6:35845484-35845506 ACTATTGCCTTTGAGAAGAATGG + Intronic
1007146492 6:39639145-39639167 ATTATTACCATTGTAAAAAAGGG - Intronic
1008417229 6:51255964-51255986 ATGCCTACCTTTGATATAAAGGG - Intergenic
1008995658 6:57655680-57655702 GTGATTACCTTTGAAGAGAAAGG - Intergenic
1009184186 6:60554449-60554471 GTGATTACCTTTGAAGAGAAAGG - Intergenic
1010036925 6:71336545-71336567 ATGATTACCTTTTTAATAAATGG + Intergenic
1010563478 6:77380146-77380168 AAAATTACCCTTGTGAAAAATGG + Intergenic
1011430389 6:87280434-87280456 AAGATTTGCTTTGTGAAAAAAGG + Intergenic
1011822142 6:91265211-91265233 ATGACTAGCTTTGGGAAAGAGGG + Intergenic
1012072842 6:94644477-94644499 ATGATGACCCTTCATAAAAAAGG + Intergenic
1012619917 6:101330777-101330799 ATGATTACATTTCAGAGAGATGG + Intergenic
1012662017 6:101911526-101911548 ATGATTACCTTTAAGTTTAAAGG - Intronic
1013415462 6:109920733-109920755 ATGATGATCTTGGAGAAACAAGG - Intergenic
1014050203 6:116943696-116943718 ATGATTACCTTTGGGAAAGGAGG + Intergenic
1014190942 6:118496011-118496033 ATGATTACATATCAGAAAAATGG + Intronic
1014685107 6:124487630-124487652 GTGTTTCCCTTTGATAAAAATGG - Intronic
1016195576 6:141334387-141334409 ATGTTTATCTTTGAAGAAAAGGG - Intergenic
1016507872 6:144804731-144804753 ATGATTACATTTCAAAGAAATGG + Intronic
1017917622 6:158844275-158844297 TTCCTTACCTTTTAGAAAAAGGG - Intergenic
1017928572 6:158932287-158932309 ATGAGTACCTTAGCTAAAAAAGG - Intergenic
1017995568 6:159529105-159529127 GTGATTTCCTTTGGGGAAAAGGG + Intergenic
1018094163 6:160370439-160370461 GTGATTACTTTTTAGAAAGATGG - Intronic
1018182133 6:161233277-161233299 AAGCTTTCCTTTGAGGAAAATGG + Intronic
1020494103 7:8825186-8825208 GTGATTACCTTTGAGAATGGGGG - Intergenic
1020975034 7:14995508-14995530 GTGATAACCTTAAAGAAAAAGGG - Intergenic
1021062974 7:16136711-16136733 ATGATTTCCTGAGAGAAAGAAGG + Intronic
1021064217 7:16153445-16153467 AATATTACCTTTTAGAGAAAAGG + Intronic
1021508053 7:21406951-21406973 ATGAGATCCTTGGAGAAAAAAGG + Intergenic
1021579337 7:22136030-22136052 ATCATTACCTTTAAGCAATAAGG + Exonic
1021890503 7:25181412-25181434 ATGACCACCTCTGAGAAGAAGGG + Intergenic
1022708423 7:32829078-32829100 ATTGTTAGCTTGGAGAAAAAAGG - Intergenic
1022741960 7:33130218-33130240 GTGAGTACTTTTGAGAAAAAAGG + Intronic
1022914753 7:34936399-34936421 ATTGTTAGCTTGGAGAAAAAAGG + Intronic
1024454265 7:49585048-49585070 ATGGTTACTGTAGAGAAAAATGG + Intergenic
1024547781 7:50536919-50536941 ATTGTTAACTTTGGGAAAAAGGG - Intronic
1024878540 7:54056539-54056561 CTGTTTTCCTTTGAGAAAAATGG - Intergenic
1025555700 7:62305369-62305391 ATGATTACATTTGAGCCCAATGG - Intergenic
1025909411 7:65816051-65816073 ATAATTGCTATTGAGAAAAAGGG + Intergenic
1026133080 7:67636448-67636470 GTGATTTCCTTTCAGAAAGACGG + Intergenic
1026658793 7:72280533-72280555 AAAATTAACTTGGAGAAAAAAGG - Intronic
1027937316 7:84624789-84624811 ATGATTTCCTTTGAGCACACTGG + Intergenic
1028325672 7:89521772-89521794 ATGATTATATTTGAAAGAAATGG + Intergenic
1028609701 7:92696614-92696636 ATGATTTACTTTGAAAAAACTGG + Intronic
1030917534 7:115335083-115335105 ATGAATACCTGTGAGAGAAGAGG + Intergenic
1032356207 7:131213068-131213090 ATGGTTACTTTTGTGAAAAGAGG - Intronic
1032452810 7:132048005-132048027 ATGTTTAACTTTGAGAAGAGAGG - Intergenic
1032955793 7:136970743-136970765 GTCAATACCTTAGAGAAAAAAGG + Intronic
1033314957 7:140289443-140289465 AAGATAACATTTGAGAAAGATGG + Intergenic
1033514634 7:142093898-142093920 ATGATTCACTTTGAAATAAAGGG - Intronic
1033795507 7:144840740-144840762 AAAATGACCTCTGAGAAAAAGGG - Intergenic
1034004984 7:147461422-147461444 CTGATTGCCCTTCAGAAAAATGG - Intronic
1034786439 7:153930233-153930255 ATAATTAGCTTTAAGAAGAAAGG - Intronic
1036447699 8:8836841-8836863 TTGGTTAACTTAGAGAAAAATGG - Intronic
1036770259 8:11574105-11574127 ATGTTTATCTTTGGGAATAAGGG - Intergenic
1037272899 8:17149258-17149280 ATGATGACATTTAACAAAAAAGG - Intergenic
1038689885 8:29751477-29751499 ATGATTACCTCTGCAGAAAAGGG + Intergenic
1038863502 8:31413761-31413783 ATGTTTACCTTTCAGAACATTGG - Intergenic
1039622140 8:39007567-39007589 AAGATTTCTTTTGAGAAAAAAGG + Intronic
1040717990 8:50281726-50281748 ATGATTATTTTTGGTAAAAATGG - Intronic
1040914739 8:52557528-52557550 ATGGTTACATGTGAGAAAACAGG - Intronic
1041390139 8:57340681-57340703 ATTATTGCCTTTGGGAAGAAGGG + Intergenic
1041805492 8:61844678-61844700 AAGATCATCTTTGATAAAAATGG + Intergenic
1042794630 8:72647852-72647874 ATGATTACATTTCAAAAAAATGG + Intronic
1043718595 8:83514680-83514702 ATGATTACATTTCAAAGAAATGG - Intergenic
1044266515 8:90188497-90188519 ATGATTTTCTTGGAGAAGAATGG + Intergenic
1045922795 8:107551897-107551919 ATGATTACATTAAAAAAAAATGG - Intergenic
1046302302 8:112311847-112311869 ATGAATTCATCTGAGAAAAATGG + Intronic
1046403098 8:113733371-113733393 ATGATACTCTTTAAGAAAAATGG - Intergenic
1046757236 8:117984511-117984533 ATGACTGACTTTGAGCAAAAGGG + Intronic
1050022778 9:1302217-1302239 ATCATTCCCTTTGAGAAACCTGG - Intergenic
1052174262 9:25438240-25438262 ATGTTTACATTAGAAAAAAAAGG + Intergenic
1052206384 9:25846296-25846318 ATTATTTCCTTAGAGAAAATGGG - Intergenic
1052385441 9:27818343-27818365 ATGTTTTCATTTGAGAAAATTGG - Intergenic
1052581023 9:30354140-30354162 GTGATTATCATTGAGAATAAGGG - Intergenic
1052722736 9:32191968-32191990 ATGATTACTTTTGAAAGCAATGG - Intergenic
1053256121 9:36616695-36616717 ATGATTGCCTCTAAGAAAACAGG - Intronic
1055188126 9:73481453-73481475 ATGATCACCTTGAAGAAAAAAGG - Intergenic
1055219677 9:73913592-73913614 ATTATTGCCAGTGAGAAAAAAGG + Intergenic
1055507958 9:76967001-76967023 ATCATTCCCTCTGAGCAAAATGG + Intergenic
1056877221 9:90345464-90345486 ATGATTACCTTAGAGACAAACGG - Intergenic
1057964226 9:99487804-99487826 ATGACCACCTTTCAGATAAATGG - Intergenic
1059896166 9:118868392-118868414 ATCATTCCATTTGATAAAAATGG + Intergenic
1062731189 9:138110474-138110496 TTGATTAACTTTGAGAGAAGAGG + Intronic
1185937409 X:4274264-4274286 ATTATTATTTTTGAAAAAAATGG + Intergenic
1186632942 X:11369791-11369813 ATGTTAAGCTTTGAGTAAAACGG - Intronic
1186645455 X:11502308-11502330 ATGATTACCTTTGGCAGACAGGG + Intronic
1186929091 X:14368690-14368712 ATGATTACCTTAGGAGAAAAAGG + Intergenic
1187448803 X:19379233-19379255 ATGATTACATTTCAGAGAGATGG - Intronic
1187643159 X:21317076-21317098 ATAATTGTCTTTTAGAAAAAAGG + Intergenic
1187683578 X:21793710-21793732 AAGATATCCTTTGAGAATAAAGG + Intergenic
1187841957 X:23498236-23498258 ATGACTAGCTTTGGAAAAAAGGG - Intergenic
1188191815 X:27180818-27180840 ATGACTAGCTTTGGGGAAAAGGG - Intergenic
1188640080 X:32490201-32490223 ATGATTACATTTAATACAAAAGG - Intronic
1189785198 X:44553100-44553122 ATGTCTACCTGTGAGAGAAAAGG - Intergenic
1190583057 X:51907269-51907291 ATTATTAACTTTGTGAAAAATGG + Intergenic
1190618574 X:52263001-52263023 GTCATTACCTTGGAGAAATATGG - Intergenic
1190626090 X:52340170-52340192 GTCATTACCTTGGAGAAATATGG + Intergenic
1191055861 X:56239763-56239785 ATGATTACATCTGGCAAAAAGGG - Intronic
1191086696 X:56575764-56575786 ATGATTACCTTTTAATAAAATGG + Intergenic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1191267798 X:58418926-58418948 AGGATTATCTTTGAGATAAATGG + Intergenic
1193544878 X:82814178-82814200 AAAATTAGTTTTGAGAAAAAGGG + Intergenic
1193764703 X:85513102-85513124 ATGTTGACCTATGAGAAAGATGG + Intergenic
1194521696 X:94926886-94926908 ATGATTACCTCTGGGTAAATAGG - Intergenic
1194726524 X:97404221-97404243 ATGATTACATTCAAGAATAATGG - Intronic
1194793951 X:98186795-98186817 ATGTTTTCATTTGGGAAAAAAGG + Intergenic
1194922121 X:99779441-99779463 ATAATTACCATTTAGAAAATTGG - Intergenic
1195296183 X:103480321-103480343 GTGGTTACCTCTGAGAAAGAAGG - Intergenic
1195331449 X:103805945-103805967 TTGATTGCTTTTGAGAAACAGGG + Intergenic
1195353719 X:104018643-104018665 ATGATGATATTTGAGAGAAATGG - Intergenic
1195500692 X:105595119-105595141 TTGATTACCTTGTAGAAGAAAGG + Intronic
1196869439 X:120098962-120098984 ATGACTACCTTAGTGAAAAGGGG - Intergenic
1197134338 X:123043463-123043485 ATGATTACATTAGATAATAAAGG + Intergenic
1197297188 X:124733240-124733262 AAAATTAGATTTGAGAAAAATGG + Intronic
1197369219 X:125605751-125605773 ATGATTTTCTTGGAGAAATAAGG + Intergenic
1197715035 X:129700509-129700531 ATGGTCACCTTTGGGAAAAAGGG + Intergenic
1198448092 X:136738809-136738831 ATGATTAGTTTTGAGGATAAGGG - Intronic
1201645841 Y:16230716-16230738 ATTATTACATTGTAGAAAAAGGG + Intergenic
1201656972 Y:16354600-16354622 ATTATTACATTGTAGAAAAAGGG - Intergenic
1202172976 Y:22070867-22070889 ATAATTATCTAAGAGAAAAAAGG - Intergenic
1202218384 Y:22515504-22515526 ATAATTATCTAAGAGAAAAAAGG + Intergenic
1202324801 Y:23680551-23680573 ATAATTATCTAAGAGAAAAAAGG - Intergenic
1202545970 Y:25989503-25989525 ATAATTATCTAAGAGAAAAAAGG + Intergenic