ID: 1125305370

View in Genome Browser
Species Human (GRCh38)
Location 15:38306357-38306379
Sequence GCTCAGAAAACAATAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125305370 Original CRISPR GCTCAGAAAACAATAATGGC AGG Intronic
900255393 1:1695556-1695578 TCTCAAAAAAAAATAAAGGCCGG - Intronic
900263954 1:1747787-1747809 TCTCAAAAAAAAATAAAGGCCGG - Intergenic
902048431 1:13543085-13543107 TCTCAGAAAAAAAAAAAGGCTGG - Intergenic
904072969 1:27816310-27816332 CCTCAGAAAAAAAAAATAGCCGG + Intronic
904120556 1:28194942-28194964 GCTCAGAAAACATTCACTGCAGG - Intergenic
904662192 1:32093706-32093728 GCTCAAAAGACATTAAGGGCCGG - Intronic
905079174 1:35302079-35302101 GCTCAGACAACAAAAATGAATGG - Intronic
905944835 1:41892821-41892843 GCTCAAAAAACAGCAAAGGCTGG + Intronic
906788366 1:48636293-48636315 GCTCAGAAAGAAAAGATGGCAGG - Intronic
906917575 1:50027520-50027542 GCTCAGAAGACACATATGGCCGG + Intergenic
906946701 1:50300729-50300751 GATCAGAATACAATAATAGCAGG + Intergenic
907675140 1:56511081-56511103 TCCCAGAGTACAATAATGGCTGG - Intronic
909104082 1:71387058-71387080 GATCACAATACAATAATAGCTGG + Intergenic
909209409 1:72804625-72804647 GATCACAATACAATAATAGCTGG - Intergenic
911400209 1:97365282-97365304 GCTAAGAAATGAATATTGGCAGG - Intronic
911424708 1:97693950-97693972 GGTCAGAAAAAAATAAAGGAAGG + Intronic
914329944 1:146658356-146658378 ACACAGAAAACAGTTATGGCTGG - Intergenic
915883271 1:159696418-159696440 GCTCAGACAATAATTAGGGCTGG - Intergenic
916981102 1:170138063-170138085 GCTCAGATAAAAATTCTGGCAGG - Intergenic
920839759 1:209544766-209544788 ACTCAGAAAACCAAAATGACTGG + Intergenic
921616237 1:217271291-217271313 GCTCAGAAAAAGAAGATGGCAGG - Intergenic
921696308 1:218214758-218214780 GGGAAGAAAACAATAATGGGGGG - Intergenic
921857916 1:220008528-220008550 GCTCAGAATAGAATACTGACAGG + Intronic
924912149 1:248525530-248525552 GCTCAGAGAAGAAAAATGGGAGG + Intergenic
1063024429 10:2164055-2164077 GCTCAGCTTACAATCATGGCAGG - Intergenic
1064701512 10:18026256-18026278 TCTCAGAAAACAAAAATAGAGGG - Intronic
1065160837 10:22919661-22919683 GCTCAGAAAACAAAAAATGAGGG - Intergenic
1068076543 10:52262941-52262963 ACTCGGAAAACAAAAATGGATGG - Intronic
1068472620 10:57484056-57484078 GCTCTGAAAAAAATAAAGTCAGG - Intergenic
1071150042 10:82623275-82623297 GCTCAGAGACCAATTCTGGCAGG - Intronic
1072870465 10:99114616-99114638 CCTGAGAAAAGAAGAATGGCTGG + Intronic
1074478377 10:113794358-113794380 GTTGAGAGAACAATAATGACAGG + Intergenic
1075039934 10:119099980-119100002 TCTCAGAAAAAAAAAAAGGCTGG + Intergenic
1075789687 10:125074951-125074973 GCCGAGAAAACAATAATAGGTGG + Intronic
1075987085 10:126797398-126797420 GGTCAGAACAAAATAATGCCAGG + Intergenic
1077803578 11:5567324-5567346 GCTCAGAAAATAATATTTCCTGG - Intronic
1077981211 11:7302678-7302700 GCTCAAAAAACATTAATGATTGG + Intronic
1079155571 11:17944221-17944243 GTTTAGAAAAAAATAAAGGCCGG - Intronic
1080519587 11:33056109-33056131 TCTCAAAAAACAACAATGGCTGG - Intronic
1081431509 11:42981774-42981796 AGTCAGAAAACAACAATTGCTGG + Intergenic
1083488307 11:62997016-62997038 GCTCAGAAGACCATCAGGGCAGG - Intronic
1087370937 11:97282736-97282758 GCTCCCAATACAATAATAGCTGG + Intergenic
1087928610 11:103949628-103949650 GCTCAGAAAGTATTAATAGCAGG - Intronic
1088135118 11:106546766-106546788 TCTCAGAAAACTATAATAGAAGG + Intergenic
1088249744 11:107852253-107852275 GCTAAAAACACAATATTGGCTGG + Intronic
1089093457 11:115898067-115898089 GCTCAAAAAATACTGATGGCTGG + Intergenic
1089363594 11:117907504-117907526 GCTCAGAGCACGAGAATGGCTGG + Intronic
1090263975 11:125342599-125342621 GCTGAGAAAACAACACAGGCCGG - Intronic
1090716265 11:129433962-129433984 GCTCAGTAAATATTCATGGCTGG + Intronic
1091291342 11:134441641-134441663 GCACAGAAAACAATATTCGAGGG + Intergenic
1091502603 12:1033465-1033487 GCTCAAAAAAAAAAAAAGGCTGG - Intronic
1092897433 12:13026283-13026305 GCCCAGAAGAGAATACTGGCAGG - Intergenic
1095317000 12:40776434-40776456 AGTCACAAATCAATAATGGCTGG - Intronic
1095957531 12:47815223-47815245 GGTCAGAAAACAAGAAAGCCAGG + Intronic
1096780688 12:53990469-53990491 GGTCATAAAACAGTAATGTCAGG + Intronic
1098142619 12:67466284-67466306 GGCCAGAATACAATAATAGCTGG - Intergenic
1098632131 12:72737081-72737103 GTTCAGAAAAGAAAAATGGATGG + Intergenic
1100645374 12:96523705-96523727 GCTCAGAGAAAAAAAATGCCGGG - Intronic
1102718093 12:114991706-114991728 GCTTAGAAAAAAATAAAAGCAGG - Intergenic
1105233546 13:18523455-18523477 GCTCAGAACCCAAGAAAGGCAGG + Intergenic
1106426049 13:29630982-29631004 ACTCAGAAAACAATAGATGCTGG - Intergenic
1107054262 13:36086395-36086417 CCTCAGACAACATTACTGGCTGG + Intronic
1108147471 13:47494703-47494725 GCTAACAAATCAATAATGACAGG + Intergenic
1109247885 13:59979381-59979403 GCTTAGAATACAATGTTGGCTGG + Intronic
1110025289 13:70530125-70530147 GCTCAGAAAAAAAAAAAGACTGG - Intergenic
1114732436 14:25007673-25007695 GCTCAGTAAACATTAGTGGAAGG + Intronic
1117245455 14:53880301-53880323 GCACAGAGAACAATAAAGGAGGG + Intergenic
1117330922 14:54711075-54711097 GTTCAGCAAACATTTATGGCAGG - Intronic
1118318552 14:64740166-64740188 GCTCAGAAAGCCACAGTGGCTGG + Intronic
1119371748 14:74151853-74151875 GATGAGAAAAAAAAAATGGCAGG - Intronic
1121031206 14:90660058-90660080 GAAAAGAAAAGAATAATGGCAGG + Intronic
1122118541 14:99539848-99539870 TTTCAGAAAAAAAGAATGGCCGG + Intronic
1122622802 14:103069359-103069381 TCTCAAAAAAAAATAAAGGCCGG + Intergenic
1124357890 15:29010765-29010787 TATTAGAAAACAAGAATGGCTGG - Intronic
1124854479 15:33374030-33374052 TGTCAGAAAACAAAATTGGCTGG + Intronic
1125305370 15:38306357-38306379 GCTCAGAAAACAATAATGGCAGG + Intronic
1127709859 15:61586114-61586136 GCTCAGGAAACAATAGATGCTGG + Intergenic
1132913155 16:2326217-2326239 TCCCAGAAAACAGCAATGGCAGG + Exonic
1133290224 16:4715670-4715692 ACACAGAAAACAATATTGGAAGG + Intronic
1136170126 16:28484140-28484162 GGTCAGAAAACCCTACTGGCTGG + Intronic
1136542220 16:30934359-30934381 TCTCAAAAAAAAAAAATGGCCGG + Intronic
1136694739 16:32067471-32067493 ACTTAGGAAAAAATAATGGCAGG + Intergenic
1136795239 16:33010733-33010755 ACTTAGGAAAAAATAATGGCAGG + Intergenic
1136874679 16:33843649-33843671 ACTTAGGAAAAAATAATGGCAGG - Intergenic
1137377212 16:47962456-47962478 GCTTAAAAAATAATAATGCCTGG - Intergenic
1138780710 16:59781704-59781726 GCTGGGAAAACAATGATTGCAGG + Intergenic
1140003611 16:71052558-71052580 ACACAGAAAACAGTTATGGCTGG + Intronic
1140128333 16:72136345-72136367 GCTCCCAAAGCAATAATGGTGGG + Intronic
1141671661 16:85495247-85495269 CCTCAGAAAACATTACGGGCAGG - Intergenic
1203097494 16_KI270728v1_random:1272393-1272415 ACTTAGGAAAAAATAATGGCAGG + Intergenic
1142936393 17:3336837-3336859 ACTCAGAAAACATTAATTGATGG - Intergenic
1148526605 17:48344068-48344090 GCTCAATAAACAATAAATGCTGG + Intronic
1150458638 17:65328580-65328602 CCTCAGAAAACAAGAATGATTGG - Intergenic
1151203944 17:72491158-72491180 GCTCATAGAACACTAGTGGCAGG + Intergenic
1151580939 17:74978370-74978392 GCTGAGAAGACCAGAATGGCTGG + Intergenic
1155077611 18:22374356-22374378 GCTCAGTGAAAAGTAATGGCTGG + Intergenic
1157951271 18:52040628-52040650 TATCAGAAAACAAGAAAGGCTGG + Intergenic
1159029886 18:63220099-63220121 GCTGAAAAAACAAGAATGTCTGG + Intronic
1160792967 19:931289-931311 TCTCAAAAAACAAAACTGGCCGG + Intronic
1161113405 19:2482499-2482521 TCTCAAAAAACAACAATGGCTGG - Intergenic
1161475474 19:4482502-4482524 TCTATGAAAAAAATAATGGCTGG - Intronic
1161804964 19:6437805-6437827 TCTCAGAAAAAAAAAAAGGCCGG + Intronic
1162082929 19:8229706-8229728 TCTCAAAAAACAAAAAAGGCTGG - Intronic
1163495566 19:17644691-17644713 TCTCAAAAAACAAATATGGCCGG - Intronic
1164111384 19:22162645-22162667 GCTCAGAAAACAGAAAGGGAAGG + Intergenic
1164195842 19:22958049-22958071 GCTCAGAAAACAGAAAGGGATGG + Intergenic
1164292960 19:23883900-23883922 GCTCAGAAAACAAAAAAGGTGGG - Intergenic
1166112135 19:40629143-40629165 GTTAAGAAAATAATAATGGCCGG - Intronic
1168027309 19:53651973-53651995 TCTCAAAAAATAAAAATGGCTGG + Intergenic
1168432865 19:56295215-56295237 GTTCAGAAAACAACAACGGGTGG + Intronic
926634046 2:15162031-15162053 GCTCAAACAACAATAGTGTCAGG - Intergenic
927272747 2:21230703-21230725 GGTCAGAAAACATTAGTAGCTGG - Intergenic
929205968 2:39293575-39293597 ACTGACAAAACAATAATTGCAGG + Intronic
929206651 2:39303431-39303453 GCTCGGAAATGAATATTGGCAGG + Intronic
930294115 2:49531654-49531676 GCTCAGTAAACTATGAAGGCTGG + Intergenic
930972393 2:57411681-57411703 GCTCACAATAGAATAATAGCTGG + Intergenic
932376380 2:71239663-71239685 GCTGAGAAAATAATAAAGACAGG - Intergenic
933246742 2:79984729-79984751 GGTCAGGGAGCAATAATGGCAGG - Intronic
939205428 2:139096455-139096477 ACTCAGAAAAAAATAATTTCTGG - Intergenic
939233303 2:139458964-139458986 TCTCAAAAAAAAATAATAGCTGG + Intergenic
939321853 2:140633380-140633402 GCTCAAAAATCAATAATCTCAGG + Intronic
941029768 2:160497595-160497617 CATCAGAAAACCATAATGTCTGG + Intergenic
944596203 2:201263632-201263654 CCTCAGAAAAAAATAATTGAGGG + Intronic
944990241 2:205227287-205227309 GATCCCAATACAATAATGGCTGG - Intronic
946637976 2:221751515-221751537 AGTCAGAAAACAATAAATGCTGG + Intergenic
946720133 2:222596567-222596589 ACTCAGTAATCAAGAATGGCAGG + Intronic
1171898812 20:30837114-30837136 GATCTCAATACAATAATGGCTGG + Intergenic
1172071445 20:32260308-32260330 GCTAAAAATACAAAAATGGCCGG - Intergenic
1172219014 20:33259488-33259510 GTTCTGAAAACAATAGTGGCAGG - Intergenic
1173520633 20:43697605-43697627 TCTCAAAAAACAACAAGGGCTGG + Intronic
1173749766 20:45468189-45468211 GCTCAGTCAACAATGAGGGCAGG - Intergenic
1176777530 21:13151738-13151760 GCTCAGAACCCAAGAAAGGCAGG + Intergenic
1177087160 21:16720379-16720401 GCTGAGAAAAGAACAATGGCTGG + Intergenic
1179814243 21:43893823-43893845 GCACTGAAAACAATTATGGTAGG + Intronic
1181541137 22:23573926-23573948 GCACACAAAACTATACTGGCAGG + Intronic
1181899211 22:26138899-26138921 GCTCAGAGAAGAAAAATAGCTGG - Intergenic
1182240466 22:28912024-28912046 GCTCAGAAGAATTTAATGGCCGG - Intronic
1182305428 22:29364708-29364730 TCTCAAAAAAAAAAAATGGCCGG - Intronic
1184750980 22:46486544-46486566 TCTCAAAAAAAAATAAAGGCTGG + Intronic
953336116 3:42095340-42095362 GGTCAGAAAACAATGCTGCCGGG - Intronic
954294952 3:49669218-49669240 GCTCAGGCAACAATTCTGGCAGG - Exonic
955569067 3:60283944-60283966 GTTCATTAAACATTAATGGCAGG + Intronic
956033319 3:65062758-65062780 GCTCATAAAACAGTTTTGGCCGG + Intergenic
956549741 3:70444948-70444970 GATCCCAAAACAATAATAGCTGG + Intergenic
957398636 3:79678768-79678790 TCTCAAAAAACTATAATTGCTGG - Intronic
958905927 3:99942350-99942372 CTCCAGAAAAAAATAATGGCAGG + Intronic
959156890 3:102677860-102677882 ACTCAGAAAAAAATAAGAGCAGG + Intergenic
960170892 3:114459719-114459741 GTTCAGAAAATAATATTGGAGGG + Intronic
960311852 3:116126465-116126487 GCTCAAAAAACAAAAATGAGGGG - Intronic
960814438 3:121658445-121658467 TCTAAGAAAAAAAAAATGGCAGG - Intronic
960873587 3:122275260-122275282 ACTCTGACAACAATAATGGCCGG + Intronic
961413487 3:126740682-126740704 GCTCAGAGAACAAGGGTGGCAGG + Intronic
961708452 3:128808058-128808080 GCTTAAAAAAAAATTATGGCCGG + Intronic
961871727 3:129993288-129993310 GCTCAGAAAATAGAAACGGCTGG - Intergenic
964890865 3:161532952-161532974 TCTCAAAAAAAAAAAATGGCCGG - Intergenic
969263883 4:6051583-6051605 GCTCAGAAAACAATTGTGAATGG - Intronic
969951735 4:10843892-10843914 TTTTAGTAAACAATAATGGCCGG + Intergenic
972976420 4:44641841-44641863 GCTAAGTGAACAATAATAGCAGG - Intronic
974057596 4:56999683-56999705 GCTCTGAACACAATAATGATGGG - Exonic
974117750 4:57601178-57601200 GCTCATAAAACCAAAATGTCTGG + Intergenic
974957687 4:68663179-68663201 GCACAGAAAACACTATTGACAGG + Intronic
975434295 4:74333886-74333908 GGTTAGGAAACAATAATGGAAGG - Intergenic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
976668864 4:87629545-87629567 GCTAAGAAAAAAATAATGTAGGG + Intergenic
980431057 4:132696773-132696795 GCAAAGAAAATAATAAAGGCTGG + Intergenic
980678503 4:136123937-136123959 ACTTAGAAAACAAAAATGGCTGG - Intergenic
982666799 4:158274956-158274978 GCTCAGAAAGGAAAAATCGCCGG + Intergenic
983318048 4:166157127-166157149 TCTCAAAAAAAAATAAAGGCAGG + Intergenic
985710176 5:1423454-1423476 CCTCAGAAAACAGTGCTGGCTGG - Intronic
990324851 5:54665123-54665145 GCTCAGATAACAAGGCTGGCAGG - Intergenic
992228074 5:74638314-74638336 GCACAGAAAACCACAAAGGCAGG + Intronic
993717518 5:91290319-91290341 GCTAAGAAAACATTCATGACAGG - Intergenic
996767047 5:127044948-127044970 GCTCAGCACCCAAAAATGGCAGG - Exonic
998762832 5:145451381-145451403 GTTCAGAAAACAAAGATGACCGG - Intergenic
1000021958 5:157325874-157325896 GCTCAGAAAAGAATCATCTCAGG + Intronic
1000057831 5:157623777-157623799 CTTCAGAAAAAAATAATAGCTGG - Intergenic
1000523443 5:162326642-162326664 ACTCAGAAAATTATAATGCCAGG - Intergenic
1001363108 5:171107470-171107492 GCCAAGAAAAAAAAAATGGCAGG - Intronic
1004853235 6:19722446-19722468 GCCCAGAAAAAAAGAATGTCTGG - Intergenic
1005805295 6:29468608-29468630 GCTCAGAAGACATGAATGACAGG + Intergenic
1006126471 6:31841969-31841991 TCTCAAAAAACAAAAAAGGCTGG - Intergenic
1006535260 6:34694751-34694773 GCACAGAAAAAAAAAATGGCGGG + Intronic
1007254022 6:40516088-40516110 GCCCAGAAAACACAAATGGATGG - Intronic
1008913323 6:56759864-56759886 GCTTAGAGGACAAGAATGGCAGG - Intronic
1009582177 6:65550055-65550077 GCTCAGTGAAAAATAATGGATGG - Intronic
1010235448 6:73571520-73571542 TCTCAGAGCACAAGAATGGCTGG - Intergenic
1011363557 6:86554262-86554284 GGACAGAAAGCAAGAATGGCAGG - Intergenic
1011514835 6:88142499-88142521 GCTTAGCAAAAAATAATGACAGG - Exonic
1012363731 6:98414323-98414345 GGTCAGGAAACAATAAATGCTGG + Intergenic
1012383537 6:98649845-98649867 CCTTAGAAAACAATAGTGGTAGG + Intergenic
1012465371 6:99511447-99511469 TCTCAAAAAATAATAATAGCCGG - Intronic
1013437282 6:110123432-110123454 GCTCAAAATTCAGTAATGGCAGG - Intronic
1017276149 6:152570989-152571011 GCTCAGAAAGCAAGAAGGGAAGG + Intronic
1018550896 6:164997714-164997736 TCTCAGGAAACATTTATGGCAGG + Intergenic
1021693046 7:23248490-23248512 GCCCAGAAAAAAATAAGGGCAGG + Intronic
1022209995 7:28199159-28199181 GTTTAGAAAATAATAAGGGCTGG - Intergenic
1025936621 7:66043101-66043123 GCTCATGAAACAATAATGTATGG - Intergenic
1025947580 7:66116149-66116171 GCTCATGAAACAATAATGTGTGG + Intronic
1025993274 7:66512012-66512034 TCTCAAAAAAAAAAAATGGCCGG - Intergenic
1027493983 7:78864607-78864629 GCTCAGAAAACTTTAATAACAGG + Intronic
1028186506 7:87792245-87792267 GATCTGAATACAATAATAGCTGG + Intronic
1028409356 7:90511456-90511478 GCACAGAAAATAGTAATGGCAGG - Intronic
1029134052 7:98355764-98355786 GCTCAGAAAAGATTTCTGGCTGG - Intronic
1029548921 7:101226301-101226323 GCTAAGAAAAAAAAAAAGGCCGG + Intergenic
1031932845 7:127703708-127703730 TCTCAAAAAAAAATTATGGCAGG + Intronic
1032941133 7:136793763-136793785 GAATAGAAAACAATACTGGCTGG + Intergenic
1034971338 7:155421344-155421366 GCTCAGACAGCCATAATGGATGG - Intergenic
1035349081 7:158231505-158231527 GCCCGCAATACAATAATGGCAGG + Intronic
1036045358 8:5133949-5133971 GCTGATAAATAAATAATGGCTGG + Intergenic
1036164567 8:6420565-6420587 GTAGAGAAAACAATGATGGCTGG - Intronic
1040572263 8:48621647-48621669 TCTTAGAAAACAATCATGGGTGG + Intergenic
1040995689 8:53399704-53399726 GCTCAGCAAACATTCATAGCAGG + Intergenic
1043771250 8:84204246-84204268 GCTCAGAAAAAAAAAATGAGAGG + Intronic
1044989478 8:97782730-97782752 TCTCAGAAAAAAAAAAAGGCTGG - Intronic
1048505659 8:135018806-135018828 GCTCAGAAAACTAAGATGGCAGG - Intergenic
1048588945 8:135803075-135803097 GCTCAGAAACAAATAGTGACTGG + Intergenic
1051283369 9:15466895-15466917 GCTTACAAAACAATAATTGAAGG + Intronic
1053085562 9:35217745-35217767 GATCAGAAAATAATTAAGGCTGG + Intronic
1054763103 9:69020998-69021020 GCTCAACAAACAATGATGGATGG + Intergenic
1054777407 9:69135198-69135220 GCTGAGTAAATAATCATGGCTGG + Intronic
1054860048 9:69942179-69942201 ACTAAGAAAACAATACTGGCTGG + Intergenic
1054955683 9:70907172-70907194 ACTCTGAAATCAATACTGGCAGG + Intronic
1055456877 9:76480940-76480962 ACTCAGAAAAAAAAAATAGCTGG + Intronic
1056911197 9:90702439-90702461 CCTTAGAAAACAATTCTGGCGGG - Intergenic
1057618661 9:96616790-96616812 ATTAAGAAAACAATAATGGAGGG + Intronic
1058370179 9:104257216-104257238 GCTCAGAAAAAAACAATACCTGG - Intergenic
1059957724 9:119535700-119535722 CCTCAGAAAACAATTCAGGCTGG + Intergenic
1060975240 9:127761398-127761420 GGCCAGGAAAGAATAATGGCTGG + Intronic
1186431413 X:9508425-9508447 GGTCAGAAAACAATAGTTGCTGG + Intronic
1186950530 X:14619512-14619534 TCACAGAAAACAATCATTGCAGG - Intronic
1186978117 X:14930149-14930171 GAGCAGAGAGCAATAATGGCTGG - Intergenic
1187150429 X:16676758-16676780 GCTCAGAAAAAAACAAGAGCAGG + Intronic
1187831303 X:23384452-23384474 GCTAGGAAAAGAATAATAGCAGG + Intronic
1189061166 X:37755047-37755069 GCTCATAAATCAGTAATGGTAGG - Intronic
1191158965 X:57306566-57306588 GGTTAGAACACATTAATGGCAGG - Intronic
1191791328 X:64975565-64975587 GCTCAGAACACAATAGCGCCAGG - Intronic
1192103762 X:68293392-68293414 TCTCAGAAACCAGTAATGGGTGG + Intronic
1193608461 X:83597730-83597752 GCTCAGATAAAAATGATGGCTGG + Intergenic
1195342829 X:103921465-103921487 GCTCGGACAAAAATAATGACAGG + Intronic
1195363963 X:104110092-104110114 GCTCAGACAAAAATAATGACAGG - Intronic
1196922389 X:120597688-120597710 GGTCCCAAAACAATAATAGCTGG + Intronic
1197677908 X:129350233-129350255 GCTCCCAATACCATAATGGCTGG + Intergenic
1198673732 X:139109610-139109632 GCTCAGAAAAAAGTGATGGCTGG - Intronic
1201279967 Y:12333362-12333384 GTTCAGAAAACAATAAATACAGG - Intergenic
1201760660 Y:17534094-17534116 GACCACAATACAATAATGGCTGG - Intergenic
1201840893 Y:18371896-18371918 GACCACAATACAATAATGGCTGG + Intergenic