ID: 1125306205

View in Genome Browser
Species Human (GRCh38)
Location 15:38318577-38318599
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3298
Summary {0: 1, 1: 1, 2: 38, 3: 367, 4: 2891}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125306205 Original CRISPR CAGGGGAAAGAGAAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr