ID: 1125307968

View in Genome Browser
Species Human (GRCh38)
Location 15:38343682-38343704
Sequence AGGTAGACACAGATTGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125307965_1125307968 20 Left 1125307965 15:38343639-38343661 CCAGCAACTCTCATACCATAGCA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1125307968 15:38343682-38343704 AGGTAGACACAGATTGTACAAGG 0: 1
1: 0
2: 0
3: 8
4: 188
1125307966_1125307968 5 Left 1125307966 15:38343654-38343676 CCATAGCAAATACAGTTTGAATT 0: 1
1: 0
2: 1
3: 22
4: 263
Right 1125307968 15:38343682-38343704 AGGTAGACACAGATTGTACAAGG 0: 1
1: 0
2: 0
3: 8
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125307968 Original CRISPR AGGTAGACACAGATTGTACA AGG Intronic
907070763 1:51532662-51532684 AGGTAGAGTTAGATTGTGCAGGG + Intergenic
907183010 1:52587334-52587356 TGGTACTCACAGATGGTACAAGG + Intergenic
913695932 1:121325586-121325608 AGGTAGAAAAAGATTATAGAGGG + Intronic
914141632 1:144954473-144954495 AGGTAGAAAAAGATTATAGAGGG - Intronic
914381306 1:147118853-147118875 AGGTAGTCACAGATTCCAGATGG - Intergenic
915702210 1:157806796-157806818 AGGGAGACACTGTTTGCACAAGG - Intronic
917309402 1:173662878-173662900 AGGTAGACAGGGATTGGAAATGG + Intronic
917592553 1:176491561-176491583 AGGTAGAACCAGATTGTGAAAGG + Intronic
920076975 1:203344343-203344365 AGCTAGACACACAGTGTATATGG + Intronic
920483258 1:206343954-206343976 AGGTAGAAAAAGATTATAGAGGG + Intronic
921297993 1:213722640-213722662 AGGGAGACCCAGAGTGAACAAGG + Intergenic
1063194907 10:3732331-3732353 AGAGAGAGAGAGATTGTACAGGG - Intergenic
1063346642 10:5318175-5318197 AGGTAGACACAGTTCCTCCAGGG - Intergenic
1063870995 10:10417559-10417581 AGGTAGTCTCAGATTGTCCCTGG + Intergenic
1064657778 10:17573157-17573179 AAGAAGATACAGAATGTACAAGG - Intergenic
1064792096 10:18969435-18969457 AGGAAGTCTCAGATTGCACATGG + Intergenic
1065263027 10:23945466-23945488 AGGTAGGCATTGATTGCACAGGG + Intronic
1065816580 10:29488152-29488174 AGGAAGACACAGCTTGGAGAAGG - Intronic
1065956282 10:30696504-30696526 AGGAAGACACAGCTTGGAGAAGG + Intergenic
1067202354 10:44184507-44184529 AGGGAGACACATAAGGTACATGG - Intergenic
1069298152 10:66872897-66872919 AGCTAAACACTGAGTGTACATGG - Intronic
1071577604 10:86740871-86740893 AAGTAGATACAGATTGGAGAAGG + Intergenic
1071585609 10:86817889-86817911 AGTTAGACAAAGATACTACAAGG + Intronic
1073090365 10:100932794-100932816 AGGTAGATACAGAGAGTACCGGG + Intronic
1073866542 10:107811011-107811033 AGGCAAAAACTGATTGTACAGGG + Intergenic
1077710462 11:4531662-4531684 AAGCAGTGACAGATTGTACAGGG + Intergenic
1081559741 11:44202646-44202668 AGGTAGACACAGACTTTCCAGGG + Intronic
1083529350 11:63404776-63404798 AGGCAGACATAAACTGTACATGG - Intronic
1084554306 11:69866748-69866770 TGTTAGGCCCAGATTGTACAGGG + Intergenic
1084606989 11:70178123-70178145 AGCTAGACCCAGAATCTACAGGG + Intronic
1086266341 11:85003072-85003094 AGTTATACACAAATTTTACATGG + Intronic
1087346947 11:96983494-96983516 AGGTAGATAGACATTTTACATGG + Intergenic
1087849067 11:103007794-103007816 GGATAGACACATATTGTATAGGG + Intergenic
1091978325 12:4844643-4844665 AGGGTGACACAGATTGCATAGGG + Intronic
1095437025 12:42201017-42201039 ACCTAGACACAGAAAGTACAAGG + Intronic
1095544843 12:43354089-43354111 AGGCAGAGACATATTGGACATGG + Exonic
1097355583 12:58597263-58597285 AGTCACACACAGATTTTACATGG - Intronic
1099822004 12:87723952-87723974 AAGTAGACTCCGATTGTAGAGGG - Intergenic
1103387042 12:120541182-120541204 AGGTAAAGCCAGATTCTACATGG - Intronic
1103957792 12:124588002-124588024 AGATAGGCACACATTGTGCATGG - Intergenic
1104857499 12:131908961-131908983 AGGTAAACACACCATGTACATGG - Exonic
1104996933 12:132664115-132664137 AGCTGGACACAGATGGTATATGG - Exonic
1106241241 13:27915421-27915443 AGGGACACACAGCTTGTGCAGGG + Intergenic
1107348299 13:39486973-39486995 AGGCAGCCACAGCTTGCACAAGG + Intronic
1107410515 13:40153708-40153730 AGGAAGCTGCAGATTGTACAAGG - Intergenic
1109801551 13:67385415-67385437 AGATGGACACTGATTCTACAAGG + Intergenic
1110953535 13:81523714-81523736 AGGGAGTCAAAAATTGTACATGG + Intergenic
1111180421 13:84655993-84656015 AGGTAGAGAGATATTGCACAAGG - Intergenic
1114377770 14:22167207-22167229 AGATAGAAACAGCATGTACAAGG + Intergenic
1114421210 14:22584798-22584820 TGGGAAACACAAATTGTACATGG + Intronic
1115368768 14:32588424-32588446 AGGCAGACACAAATGGGACAAGG - Intronic
1116164591 14:41318408-41318430 AGGTAGACACATAGTGAACATGG - Intergenic
1120411723 14:84165644-84165666 AGGTATACACACATTGTGGAGGG + Intergenic
1121517417 14:94561745-94561767 AGGGACACACAGCTGGTACAGGG + Intronic
1121677758 14:95768187-95768209 ATGTGGACACAGATTTTTCAAGG - Intergenic
1125100121 15:35902712-35902734 AGGCAAAGACAGCTTGTACAGGG - Intergenic
1125292838 15:38168669-38168691 AAATAGAAACAGATTGTTCAGGG + Intergenic
1125307968 15:38343682-38343704 AGGTAGACACAGATTGTACAAGG + Intronic
1129866069 15:78909761-78909783 AAGTGGACACAGGTTGTACCAGG - Intergenic
1129920524 15:79315751-79315773 AGGCAGGCACAGATGGTTCAAGG - Intronic
1133386582 16:5375061-5375083 TGGTAGAAACAGATTTTAAATGG + Intergenic
1134165937 16:11929538-11929560 AGGTAGAGATAGATTGTGTAAGG - Intronic
1134494781 16:14724203-14724225 AGGTAGAGATAGATTGTGTAAGG + Intronic
1134500164 16:14763323-14763345 AGGTAGAGATAGATTGTGTAAGG + Intronic
1134526706 16:14949935-14949957 AGGTAGAGATAGATTGTGTAAGG + Intronic
1134545700 16:15106413-15106435 AGGTAGAGATAGATTGTGTAAGG - Intronic
1134580415 16:15365727-15365749 AGGTAGAGATAGATTGTGTAAGG - Intronic
1134714284 16:16348412-16348434 AGGTAGAGATAGATTGTGTAAGG + Intergenic
1134722159 16:16391776-16391798 AGGTAGAGATAGATTGTGTAAGG + Intronic
1134945268 16:18320093-18320115 AGGTAGAGATAGATTGTGTAAGG - Intronic
1134952532 16:18360246-18360268 AGGTAGAGATAGATTGTGTAAGG - Intergenic
1135311328 16:21406952-21406974 AGGTAGAGATAGATTGTGTAAGG - Intronic
1135364280 16:21839403-21839425 AGGTAGAGATAGATTGTGTAAGG - Intronic
1135447563 16:22531945-22531967 AGGTAGAGATAGATTGTGTAAGG + Intronic
1136150484 16:28344846-28344868 AGGTAGAGATAGATTGTGTAAGG - Intronic
1136166721 16:28458684-28458706 AGGTAGAGATAGATTGTGTAAGG - Intronic
1136196254 16:28656348-28656370 AGGTAGAGATAGATTGTGTAAGG + Intronic
1136212595 16:28770473-28770495 AGGTAGAGATAGATTGTGTAAGG + Intronic
1136257316 16:29050387-29050409 AGGTAGAGATAGATTGTGTAAGG + Intronic
1136308034 16:29385948-29385970 AGGTAGAGATAGATTGTGTAAGG - Intronic
1136321450 16:29487492-29487514 AGGTAGAGATAGATTGTGTAAGG - Intronic
1136436130 16:30227462-30227484 AGGTAGAGATAGATTGTGTAAGG - Intronic
1138291218 16:55848628-55848650 AGATAGAAACAGATAGTTCACGG - Intronic
1138670024 16:58606423-58606445 AGGGGAACAAAGATTGTACAAGG + Intronic
1139855726 16:69978375-69978397 AGGTAGAGATAGATTGTGTAAGG - Intergenic
1140367007 16:74389710-74389732 AGGTAGAGATAGATTGTGTAAGG + Intronic
1141966444 16:87447964-87447986 TTGTACACACAGATTGTCCAGGG - Intronic
1143254491 17:5545634-5545656 AGGAAGACAGTGATTGTCCAGGG - Intronic
1145068532 17:19782390-19782412 AGGTAGACACAAAGATTACAAGG + Intronic
1145115073 17:20202073-20202095 ATGCACACACAGACTGTACATGG + Intronic
1146279301 17:31534828-31534850 TAGTAGACTCAGATTTTACATGG + Exonic
1148561159 17:48607267-48607289 AGATACACACAGAATGTAAAAGG + Exonic
1149740552 17:59041711-59041733 TGGTAGCCACTGCTTGTACATGG - Intronic
1150771000 17:68040844-68040866 AGGGACAGACAGATAGTACAAGG + Intronic
1152575590 17:81139421-81139443 AGGAAGACACAAGTTGCACACGG + Intronic
1155051769 18:22154584-22154606 AGGTAGGTACACATTTTACAGGG - Intergenic
1158660441 18:59382425-59382447 AGACAGACACACATTTTACATGG + Intergenic
1158877458 18:61746969-61746991 AGGTAAACCCATATTGTTCAAGG - Intergenic
1162652624 19:12102263-12102285 GGGTGGACAGACATTGTACAGGG + Intronic
1167431595 19:49458456-49458478 AGGTAGAGACAGTTTGGAAAGGG - Intronic
926278190 2:11422179-11422201 AGGTGGAAACAAATTGTAAAAGG + Intergenic
926936010 2:18087064-18087086 AAGTAGACAGAGATTAAACAAGG - Intronic
928599084 2:32886252-32886274 AGGTAGACACAGAGTGCTGATGG + Intergenic
928892914 2:36226080-36226102 AGCTAGACAAAGATATTACAAGG + Intergenic
932831672 2:74996343-74996365 AGGAAGCCACAGATGGTCCAAGG - Intergenic
932875287 2:75444781-75444803 AGGTAGGCATAGATTGGAAAGGG + Intergenic
933386088 2:81612108-81612130 AGGTACACACAAATTGTATTAGG - Intergenic
937199459 2:120189447-120189469 ATGTAGACACAGGTTGTGTAGGG + Intergenic
938249313 2:129801835-129801857 AGCTAGTCACATATTGTAGAGGG - Intergenic
938847953 2:135231114-135231136 AGTTAGACACAGGAAGTACATGG - Intronic
939206423 2:139109988-139110010 AGATAGACAAAGATGCTACAAGG - Intergenic
939399130 2:141668687-141668709 AGGAAGAATCAGATTATACATGG - Intronic
944688186 2:202136433-202136455 AGCTAGACACAGATTGCTGATGG + Intronic
947141350 2:227021904-227021926 AGGTAGAAACAAATTGCAAAGGG + Intronic
1169358830 20:4930332-4930354 AGGTTGACACAGATTTTCTAGGG - Intronic
1170404462 20:16021544-16021566 GGGAAGACACAGACAGTACAAGG - Intronic
1170702678 20:18717390-18717412 ACTTATACACAGACTGTACATGG - Intronic
1172310993 20:33918356-33918378 AGCAAGACACAGGTGGTACAGGG + Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176836908 21:13801509-13801531 CAGTAGACACAGATTTTCCAGGG + Intergenic
1178274062 21:31219935-31219957 AGGTAAACAAAGGTTGTAAAAGG + Intronic
1184691774 22:46120548-46120570 AGGCAGACACAGAATGTACCAGG - Intergenic
949999326 3:9644664-9644686 AGCTAGACACAGAATACACAGGG + Intergenic
951324450 3:21285524-21285546 AGGCAGAGAGAGCTTGTACAGGG - Intergenic
953657430 3:44864769-44864791 AGGTAGACACAGCAGGTACATGG - Intronic
955260354 3:57383232-57383254 AAGTAGACAAAGATTCTTCAGGG - Intronic
956610184 3:71114699-71114721 AGGGAGAGACAGATTCGACAAGG + Intronic
957116508 3:76033821-76033843 AGGTAGAAACACAATCTACATGG - Intronic
960641517 3:119828650-119828672 AGGGAGACACAGAATATCCAAGG + Intronic
963169274 3:142234603-142234625 AGGTAAAGAAAGATTATACAAGG + Intergenic
963614841 3:147523543-147523565 AGGTAAACATTGACTGTACATGG - Intergenic
965169390 3:165241830-165241852 AGCTAGACAAAGAAGGTACAGGG - Intergenic
968066195 3:195761160-195761182 AGGTGGACACAGATGGAATAAGG - Intronic
969142699 4:5093267-5093289 ACACAGACACAGACTGTACATGG + Intronic
971789146 4:31144927-31144949 AGGTACTTACAGATTATACAAGG - Intronic
977391882 4:96420804-96420826 ATGTAGACCAAGATTGTTCATGG - Intergenic
978354261 4:107854229-107854251 AGATAGTCCCATATTGTACATGG - Intronic
980652437 4:135735995-135736017 AAGTAGACACAGATAGTTCATGG - Intergenic
980720268 4:136686619-136686641 AGGCAGAGACAGCTTGTGCAGGG + Intergenic
984731495 4:183072441-183072463 GGGTAAACACAGATTGAACCAGG - Intergenic
985104695 4:186489179-186489201 AGGTAGTCACAGGTTTCACAAGG - Intronic
986519813 5:8602702-8602724 AGGGACACACAGAATGTGCAAGG + Intergenic
988297958 5:29390660-29390682 AGGAAGACAGAGATTGTCAAGGG - Intergenic
989364556 5:40641095-40641117 ACACAAACACAGATTGTACATGG + Intergenic
991251931 5:64572438-64572460 AGGAAGAAATAAATTGTACAAGG + Intronic
995207572 5:109499505-109499527 GGGTACACAGAGATTGTCCAAGG + Intergenic
995494468 5:112726254-112726276 AGGAAGATTCAGGTTGTACACGG + Intronic
1000836263 5:166158137-166158159 AGGTAGCCAGAAGTTGTACAGGG - Intergenic
1005755509 6:28922163-28922185 AGATAGACACAGATTGCCAAAGG - Intronic
1006098926 6:31673587-31673609 AGGTAAACACAGATTAAAGAGGG + Intronic
1008964163 6:57297589-57297611 AGATAGTCACAGATTATAAACGG + Intergenic
1009062798 6:58417676-58417698 TGGGAGACAGACATTGTACAGGG + Intergenic
1009250470 6:61292223-61292245 TGGGAGACAGACATTGTACAAGG + Intergenic
1009349745 6:62660013-62660035 AGGTAGATGCAGAGTGTATAGGG - Intergenic
1010454155 6:76035538-76035560 AGGTGAACACAGATTGTGTAGGG + Intronic
1013886847 6:114977609-114977631 AGGTATCCACAGATTGTCTAAGG + Intergenic
1016312354 6:142747553-142747575 ACATACACACACATTGTACATGG - Intergenic
1016359283 6:143250616-143250638 AGTTAGACACACATTGAGCAGGG + Intronic
1016601530 6:145866906-145866928 AGGTAGACAGAGAGGGGACAGGG + Intronic
1022479764 7:30735070-30735092 TGGAAGAAACAGATTGTGCAGGG - Intronic
1022520959 7:31006621-31006643 AGGGAGACACAGATATTTCATGG + Intergenic
1022557364 7:31311863-31311885 AGGGAGACACAGGTTGTCCCAGG - Intergenic
1024058330 7:45680381-45680403 AGTGAGCCACAGATAGTACAAGG - Intronic
1024557741 7:50617868-50617890 AGCTACACACAGATTTTCCAAGG + Intronic
1024607108 7:51031055-51031077 ACGGAGACGCAGATTGTTCATGG + Intronic
1028938653 7:96494041-96494063 AGGAAGACACAAATTGCAAAAGG + Intronic
1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG + Intronic
1038130218 8:24722101-24722123 AGGTAAGCACAAATTGAACAAGG + Intergenic
1038491018 8:27971288-27971310 AGGTAGTCACAGAGTCTGCATGG + Intronic
1041908085 8:63055428-63055450 AGTTAGATACTGATTATACAAGG + Intronic
1042209539 8:66366129-66366151 ATGGAGACAGAGATAGTACATGG - Intergenic
1044912674 8:97077537-97077559 ACATAAACACAGATTGTACATGG - Intronic
1045990468 8:108300623-108300645 ACCTAGACACAGGTTGCACATGG + Intronic
1046365348 8:113222580-113222602 ATGTAGATAAAAATTGTACATGG + Intronic
1047843436 8:128779424-128779446 AGGTAGACACAGACTGATAATGG - Intergenic
1048679626 8:136825512-136825534 AGTGAGACACACATTGCACAGGG - Intergenic
1048768673 8:137871092-137871114 AGCAAGAAACAGAGTGTACAAGG + Intergenic
1051318791 9:15876578-15876600 ATGTAGACACATATGTTACATGG + Intronic
1052961814 9:34304508-34304530 AGGTAGACAGTGATTGGATAGGG + Intronic
1055932053 9:81569160-81569182 AGGTAGGTACAGAAGGTACAGGG + Intergenic
1056670104 9:88620167-88620189 AGGTAGGCATAAATTGGACAAGG - Intergenic
1057494803 9:95552728-95552750 AGGAAGACACAAATTCAACAGGG - Intergenic
1059254775 9:112919691-112919713 AGGAAGAGAGAGATTGTAAATGG - Intergenic
1060449261 9:123721703-123721725 AGGTAAAGACAGCTGGTACAGGG - Intronic
1187230070 X:17413075-17413097 AGGTAGTCACATATTCTACTAGG - Intronic
1190740187 X:53283454-53283476 AGGTAGACAAAGTGTGCACATGG + Intronic
1191967992 X:66781848-66781870 GGAAAGACACAGATTGTAGAAGG - Intergenic
1192794560 X:74415969-74415991 AGGAATACATAGATTGGACAAGG - Intergenic
1195007903 X:100704769-100704791 AGGTAGACAGAGAGTGAAAAAGG + Intronic
1195667546 X:107444672-107444694 AGGTAAACACAGATGGTAATTGG - Intergenic
1195833101 X:109082395-109082417 AGGTAAACACTGATTACACATGG - Intergenic
1195888396 X:109666599-109666621 AGGCAGACACAGCTGTTACAAGG + Intronic
1197313246 X:124931828-124931850 AGGTAGACAGAGATTGTAAGGGG + Intronic
1198915612 X:141668181-141668203 AAATAGAAACAGATTGTACTAGG - Intronic
1199435149 X:147804646-147804668 AGGTAGAAAGAGATAGTAGAAGG + Intergenic
1199775531 X:151008207-151008229 AGCTAGACACAAAGAGTACATGG + Intergenic
1200943908 Y:8812651-8812673 AAGTAGAAACAGATTGTACTAGG - Intergenic