ID: 1125313539

View in Genome Browser
Species Human (GRCh38)
Location 15:38406692-38406714
Sequence CAAGCTACCCCACGTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125313537_1125313539 21 Left 1125313537 15:38406648-38406670 CCTGAGAAGGTGACTCAGTCTAC No data
Right 1125313539 15:38406692-38406714 CAAGCTACCCCACGTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125313539 Original CRISPR CAAGCTACCCCACGTGAAGT GGG Intergenic
No off target data available for this crispr