ID: 1125315868

View in Genome Browser
Species Human (GRCh38)
Location 15:38430495-38430517
Sequence GTGTCTCAAAAGGACCACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125315862_1125315868 20 Left 1125315862 15:38430452-38430474 CCTCAGAATTTTCTTACATGGCA No data
Right 1125315868 15:38430495-38430517 GTGTCTCAAAAGGACCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125315868 Original CRISPR GTGTCTCAAAAGGACCACTT GGG Intergenic
No off target data available for this crispr