ID: 1125316576

View in Genome Browser
Species Human (GRCh38)
Location 15:38438807-38438829
Sequence TCTTGTAGGGAGCAGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125316569_1125316576 24 Left 1125316569 15:38438760-38438782 CCCTTTTACTTCTGAGTCTAAAT No data
Right 1125316576 15:38438807-38438829 TCTTGTAGGGAGCAGATGGCTGG No data
1125316570_1125316576 23 Left 1125316570 15:38438761-38438783 CCTTTTACTTCTGAGTCTAAATG No data
Right 1125316576 15:38438807-38438829 TCTTGTAGGGAGCAGATGGCTGG No data
1125316568_1125316576 27 Left 1125316568 15:38438757-38438779 CCACCCTTTTACTTCTGAGTCTA No data
Right 1125316576 15:38438807-38438829 TCTTGTAGGGAGCAGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125316576 Original CRISPR TCTTGTAGGGAGCAGATGGC TGG Intergenic
No off target data available for this crispr