ID: 1125318482

View in Genome Browser
Species Human (GRCh38)
Location 15:38457683-38457705
Sequence TGTAATGGCAAGAATAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125318482 Original CRISPR TGTAATGGCAAGAATAGAGG TGG Intronic
901945827 1:12702694-12702716 TGGAAAGGCAAGGATAAAGGAGG - Intergenic
905052067 1:35060468-35060490 TCTATTAACAAGAATAGAGGAGG + Intronic
906285653 1:44586127-44586149 TTTAATGGGAAGAAATGAGGTGG + Intronic
908763786 1:67536332-67536354 TGTAATGGGAAAAATTGAGACGG + Intergenic
909535253 1:76728552-76728574 AATAATGGCAGGAAAAGAGGTGG - Intergenic
910185501 1:84535850-84535872 TGTAATGGCAATAATAATGATGG + Intergenic
911653034 1:100411175-100411197 TGGAATGCCAATAATATAGGAGG - Intronic
913115655 1:115694294-115694316 TCAAAAGGCAAGAACAGAGGCGG - Exonic
916097338 1:161362921-161362943 TGTTATTGAAAGAAGAGAGGTGG + Exonic
916646456 1:166790677-166790699 GGAAATGGCAAAAAAAGAGGAGG - Intergenic
917091012 1:171353316-171353338 TATGATGGCAAGATTAGAAGTGG - Intergenic
918190954 1:182174206-182174228 TTTAATGGAAAGAAAAGGGGTGG - Intergenic
919488062 1:198168871-198168893 TGTAATGGCTGGAATAAAGTAGG + Intronic
920940879 1:210481101-210481123 TGCTATGGCAAAAATAGAGCAGG + Intronic
923991705 1:239444945-239444967 AGTAAAGACAAGAAGAGAGGAGG + Intronic
1069089354 10:64180729-64180751 TGAAATGGTAAGAATGGAGTAGG - Intergenic
1069113568 10:64476161-64476183 TCTAATGGCAAAGGTAGAGGAGG + Intergenic
1069303316 10:66936379-66936401 TGTGATGGCAAACTTAGAGGAGG - Intronic
1069522570 10:69136179-69136201 TCTTCTGGCAAGAATATAGGTGG + Intronic
1070413103 10:76162730-76162752 TGTAATCCCAGGATTAGAGGTGG - Intronic
1070902356 10:80041444-80041466 TGTGATGGCAAGATTTTAGGAGG + Intergenic
1071137141 10:82466079-82466101 AGTGACGGCAAGAATAGAGGAGG - Intronic
1074509007 10:114096144-114096166 TGAAATGTCAAGAATGGGGGAGG + Intergenic
1075301786 10:121331283-121331305 TGCAATGGGAAGAATGGTGGTGG - Intergenic
1077956924 11:7030934-7030956 TGGAAGAGCAAGCATAGAGGCGG + Intronic
1079084431 11:17435181-17435203 TGTTATTGAAAGAAGAGAGGCGG - Intronic
1079469380 11:20763812-20763834 TGGAAGGGCAGGAATGGAGGGGG + Intronic
1080313660 11:30924106-30924128 TTTAATGGTAAGTATAGATGAGG - Intronic
1080821764 11:35813949-35813971 TATAATGGCATGAACAGTGGAGG + Exonic
1081050091 11:38328708-38328730 TGTAAATGAAAGTATAGAGGTGG + Intergenic
1081780894 11:45711438-45711460 TATAAGGGCAGGACTAGAGGAGG + Intergenic
1083468516 11:62865656-62865678 GAAAAAGGCAAGAATAGAGGAGG - Intronic
1088739147 11:112752570-112752592 TGGTATGGCAAGCCTAGAGGAGG - Intergenic
1088973330 11:114792394-114792416 TGTAAAGTCAGGAATAGATGGGG - Intergenic
1089787801 11:120920599-120920621 TGTGAGGGCAAGAAGAGAGTAGG - Intronic
1090024801 11:123158369-123158391 TTTAATGGCTAGAACAGTGGTGG + Intronic
1090476155 11:127022581-127022603 TGTAATATCAAGCATTGAGGAGG + Intergenic
1091531748 12:1363810-1363832 TGTAATGGCAACAATTTGGGAGG - Intronic
1092486137 12:8903483-8903505 TGTAAAGGGAACAAGAGAGGGGG - Intergenic
1092593353 12:9972947-9972969 TGGATTGGCAGGAAAAGAGGTGG - Intronic
1093224467 12:16465124-16465146 AGTAATGGCAAGAGGAGGGGTGG + Intronic
1095203604 12:39413810-39413832 TATTATGGCAAAAAAAGAGGAGG - Intronic
1096705892 12:53421920-53421942 TGTAATACAAAGAATAGAGCCGG + Intergenic
1097039443 12:56146382-56146404 TGTAATGGCAACACTTGGGGAGG + Intergenic
1098153564 12:67573350-67573372 TGTAGCGGCAAGAATAGAAAAGG + Intergenic
1106004756 13:25758240-25758262 TGAAATGGAAACAATTGAGGAGG + Intronic
1106452337 13:29894476-29894498 TGACATGGTGAGAATAGAGGAGG - Intergenic
1106511036 13:30412773-30412795 TATAATGTCCAGAATAAAGGAGG - Intergenic
1106858168 13:33875249-33875271 TGCGATGACAAAAATAGAGGGGG + Intronic
1108838239 13:54578722-54578744 TGGAATGGTAAAAATAAAGGGGG - Intergenic
1109390288 13:61683396-61683418 TGTAATGGGAAGAATCCAGTGGG + Intergenic
1109565282 13:64106244-64106266 TGTAATGGTGAGCACAGAGGTGG - Intergenic
1111999170 13:95193968-95193990 TGGAATGGCAAGGAGACAGGAGG - Intronic
1112528865 13:100181230-100181252 TGTTATGGCAAGAAGAGAGCTGG + Intronic
1113198145 13:107833594-107833616 TGTAATGGAAAGGATTGAGAAGG - Intronic
1113806722 13:113114293-113114315 TGTAATGGAAAGTAGAGAAGGGG - Intronic
1116559029 14:46353420-46353442 TATAATGGCAAACATAGATGAGG - Intergenic
1117181433 14:53195889-53195911 TGTGATGGAAAAAATAGAGTAGG + Intergenic
1117443387 14:55780516-55780538 TGTAATGACATGGAGAGAGGCGG - Intergenic
1117974870 14:61287386-61287408 TGTACTGGAAAGAAGAGAGGGGG + Intronic
1119112353 14:71986890-71986912 TATGATGCCAAGAGTAGAGGTGG - Intronic
1119903891 14:78284308-78284330 AGCAAAGGCAAGAAGAGAGGAGG - Intronic
1121963860 14:98286445-98286467 TGCAATGGCATGAATAGAGCTGG - Intergenic
1122031650 14:98916598-98916620 TGCAATGGCAATGACAGAGGTGG - Intergenic
1122801491 14:104232305-104232327 TGTAATGGTAAGGATGGTGGTGG - Intergenic
1125318482 15:38457683-38457705 TGTAATGGCAAGAATAGAGGTGG + Intronic
1125702308 15:41697956-41697978 GGGAATGGCAAGAACACAGGAGG - Intronic
1126161398 15:45616966-45616988 TATAATAGCAAGGAGAGAGGAGG + Intronic
1126804911 15:52338252-52338274 AGCAGTGGCAAGAATAGGGGAGG + Intronic
1126943370 15:53790461-53790483 TCAAATGGCAAGAACACAGGCGG + Intergenic
1128023284 15:64412369-64412391 TGAAATGCAAAGAATGGAGGAGG - Intronic
1130311600 15:82760865-82760887 TGTAGAGGGAAGAATAAAGGGGG - Intronic
1131853171 15:96564362-96564384 AGTCATGGCAAGAATTGCGGGGG - Intergenic
1131934925 15:97493008-97493030 TGGTATGGGAAGAATAGAAGGGG + Intergenic
1132031978 15:98445876-98445898 TGTTGTGGCAAGAACAAAGGAGG - Intronic
1132113976 15:99122537-99122559 TGTAGTTGTAAGAATAGAGTTGG + Intronic
1134690561 16:16188665-16188687 GGTAGGGGCAAGAACAGAGGCGG - Intronic
1137870047 16:51941090-51941112 TCTGCTGGCAAGAATAGTGGAGG + Intergenic
1139340289 16:66263959-66263981 TATAATGGGAAGCATAGAGGTGG - Intergenic
1140051453 16:71484968-71484990 TGTAATGACAAGACTTGAGGTGG - Intronic
1140354291 16:74291842-74291864 TGTAATGGCTGGAATAGCTGGGG + Intergenic
1140658135 16:77161259-77161281 TTTGATGGGAAGAAGAGAGGGGG + Intergenic
1141874265 16:86811151-86811173 TGCAATGGTAAGAATAGACACGG - Intergenic
1142730984 17:1857530-1857552 TGTTATTGAAAGAAGAGAGGTGG - Intronic
1143027501 17:3949817-3949839 TGTATTGTCAAGAATCGATGAGG + Intronic
1143776851 17:9205253-9205275 TATGGTGGCAAGAATAGATGGGG + Intronic
1150680455 17:67280247-67280269 TGAATTGGCAAGAAGAGGGGAGG - Intergenic
1155198253 18:23495247-23495269 TGTAATGGCAGGTAGGGAGGAGG + Intergenic
1158531720 18:58268604-58268626 GGAAAAGGCAAGAATAGAGATGG + Intronic
1159669326 18:71203565-71203587 TGTGATGGCAAGCCTAGAGGTGG + Intergenic
1162201195 19:9021499-9021521 TATAAAGGGAAAAATAGAGGAGG + Intergenic
1162546016 19:11330184-11330206 AGCAATGGCAAGAATAAAAGGGG + Intronic
1164157274 19:22604295-22604317 TGGGTTGGCCAGAATAGAGGAGG + Intergenic
927790476 2:26005581-26005603 TGTAATGGCCAGAGTGAAGGTGG - Intergenic
927812419 2:26187466-26187488 TGTGAGGGCTTGAATAGAGGAGG - Exonic
929316482 2:40485103-40485125 TGGATTAGCAAAAATAGAGGAGG + Intronic
929948859 2:46390807-46390829 AGTAATGTTAACAATAGAGGAGG - Intergenic
930629117 2:53733154-53733176 TGAAATGGGAAGGATAGAGAAGG + Intronic
930878798 2:56248955-56248977 TGTATTGGCAAGAACAGATGGGG + Intronic
931166950 2:59758589-59758611 TTGAATGGCAAGAAAGGAGGTGG - Intergenic
932936528 2:76109529-76109551 TGTAATGGCAAAAATTGTGTAGG - Intergenic
935805825 2:106746717-106746739 TCTAAAGGTAAGAATAAAGGTGG - Intergenic
936416149 2:112314223-112314245 TGTAATGCAAAGAATATAGGAGG + Intronic
937509446 2:122577573-122577595 TGAAAGGGCAAGCAGAGAGGTGG + Intergenic
939679896 2:145117398-145117420 TGGAATGAAATGAATAGAGGGGG + Intergenic
941066609 2:160910243-160910265 TGTCTTGGCAAGAAAGGAGGAGG + Intergenic
942616680 2:177798245-177798267 TGTTAGGGGAAGCATAGAGGAGG - Intronic
943313513 2:186356867-186356889 TGTAATCGCAACAATTTAGGAGG + Intergenic
946521673 2:220471817-220471839 TGTGATGGCATGAATAGATGGGG + Intergenic
947070469 2:226282487-226282509 TTTATTGACAAGAATAGATGAGG - Intergenic
1170387211 20:15832416-15832438 TGGAATGGAAAAAATACAGGGGG + Intronic
1173308923 20:41878562-41878584 TGTAATTGAAAGAATTGAGATGG - Intergenic
1177412499 21:20748557-20748579 TGAAATGGCAGGAATAGTGCTGG + Intergenic
1177434836 21:21038059-21038081 GGTTATGGCTAGAACAGAGGAGG - Intronic
1178120504 21:29465324-29465346 AGTAATGGCAAAAATATATGTGG + Intronic
1180202539 21:46233693-46233715 AGTTATGGCAAGAAGACAGGGGG + Intergenic
1181119999 22:20659517-20659539 GGTACTGGCAAGAAAAGGGGGGG - Intergenic
1182387611 22:29958873-29958895 TGTTTTGGTAAGAATAGGGGAGG + Intronic
1182696229 22:32200869-32200891 TGTAAGGTGAAGAATCGAGGCGG - Intronic
1182715880 22:32356028-32356050 TGTAAGGTGAAGAATTGAGGCGG + Intronic
1183125320 22:35773923-35773945 TGCAAGGTCAAGAATACAGGGGG + Intronic
1184273692 22:43398768-43398790 GGAAATGGCCAGAAGAGAGGGGG - Intergenic
954984975 3:54782324-54782346 TGAAATGGAAAGAATAGTGGTGG + Intronic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
956347399 3:68295864-68295886 TATAATGCCAGGAATACAGGAGG - Intronic
957242580 3:77677589-77677611 GGAAAGGGCAAGAATTGAGGAGG - Intergenic
958526511 3:95267528-95267550 TGTAATCCCAAGAGGAGAGGTGG - Intergenic
958621236 3:96564620-96564642 TGTAATAGTAATAATAGAGAAGG + Intergenic
961345304 3:126260171-126260193 AGGAAGGGGAAGAATAGAGGAGG - Intergenic
961980512 3:131073093-131073115 TGTCAGTGCAAGAATAGAGCTGG - Intronic
963178692 3:142330257-142330279 TGGAATTGCAAGAATTGAGGTGG - Intronic
963517917 3:146331770-146331792 TGTGATTGCAAGAATACTGGGGG + Intergenic
964493634 3:157264673-157264695 TGAAATGGCAATAATAGCAGTGG + Intronic
965585501 3:170314324-170314346 GGTAAGGGCAAGAACAGAGCAGG - Intergenic
966060689 3:175750475-175750497 TGTTATGGAAAGAATGGAGCTGG - Intronic
966079403 3:175980856-175980878 AGTAATGGAAATAAAAGAGGTGG - Intergenic
966720819 3:183061276-183061298 TGAAATGGGAAGACTAAAGGGGG + Intronic
966743870 3:183257510-183257532 TGTAATGCCTAGAATAGGGCAGG + Intronic
970081832 4:12296053-12296075 TGTATTGGAAAGATTAGAAGAGG - Intergenic
970720279 4:18980326-18980348 AGTAATTGCAAGAAGAGGGGAGG - Intergenic
970799991 4:19961726-19961748 TGTAATAGAAAGCAAAGAGGAGG + Intergenic
970943876 4:21667302-21667324 TGTGAAATCAAGAATAGAGGTGG - Intronic
972152351 4:36109273-36109295 AATAATGGCAAGAATAAAGAAGG + Intronic
973230478 4:47835266-47835288 TGGAATGCCAAGAATAGTGATGG + Intronic
973862731 4:55081278-55081300 CCTAAAGGTAAGAATAGAGGAGG - Intronic
978289328 4:107118799-107118821 AGGAATGGCATGAACAGAGGAGG - Intronic
981504441 4:145483214-145483236 TACAATGGAAAGAAAAGAGGGGG - Intronic
982187075 4:152813444-152813466 TGAAAAGGCAGGAAAAGAGGAGG - Intronic
983974128 4:173911824-173911846 TGGAATGGCAAGAGCAGAGATGG + Intergenic
984545794 4:181100642-181100664 TTCAATGGCAAGAATAAAGTTGG + Intergenic
985007826 4:185551754-185551776 TGTAATGGCTAGTATATAGCAGG - Intergenic
990966882 5:61457970-61457992 TTTAATGGCAATTAAAGAGGGGG - Intronic
993266065 5:85727825-85727847 TGTAATTCAAAGTATAGAGGAGG + Intergenic
995387618 5:111605292-111605314 GGTAAAGGTAAGAATAGAGAGGG + Intergenic
996034735 5:118746032-118746054 TGTACTGGGAGGAACAGAGGAGG + Intergenic
996745990 5:126846359-126846381 TGTTTTGGCAAGAAAAGAAGGGG - Intergenic
997911941 5:137883534-137883556 TGTGTTGCCAAGAATAGAGCAGG + Exonic
1000658658 5:163912979-163913001 AGTAATGGAAAGAATGGAGAGGG + Intergenic
1002207538 5:177573953-177573975 TAAAGTGGCAAGAATAGAGGTGG + Intergenic
1006185370 6:32178645-32178667 TGTACTGGTGAGAATCGAGGAGG + Exonic
1007899003 6:45392845-45392867 TGTAATGGAAATAACAGAAGGGG - Intronic
1008681239 6:53875025-53875047 TGTAAAAGAAAGAAAAGAGGAGG + Intronic
1009029089 6:58035389-58035411 GGTAATGGCAAGACTGGAGGAGG - Intergenic
1009204629 6:60786787-60786809 GGTAATGGCAAGACTGGAGGAGG - Intergenic
1010277030 6:73980451-73980473 TGTAATGCCAAGACTTGGGGGGG - Intergenic
1011222177 6:85066236-85066258 TGTGATGGCCAGGAGAGAGGTGG - Intergenic
1013000311 6:106015274-106015296 TTTAAAGGAAAGAAAAGAGGAGG - Intergenic
1013606163 6:111750685-111750707 TGTACTGGCATGAATCTAGGTGG - Intronic
1014780117 6:125555669-125555691 TGTGAAGGGAAGAATGGAGGTGG + Intergenic
1019272078 7:155948-155970 TGAAATGGAAAGAATCCAGGAGG + Intergenic
1020214919 7:6182804-6182826 CTTAATGGAAACAATAGAGGCGG - Intronic
1020352419 7:7235752-7235774 TATAAAAGAAAGAATAGAGGAGG - Intronic
1021258315 7:18422202-18422224 TAAAATGGCAAGAAAAGAGTTGG + Intronic
1021338639 7:19435411-19435433 GGGAATGGCAAAAATAGATGTGG - Intergenic
1023389748 7:39698227-39698249 TGTGATGGCAATAAGAGATGGGG - Intronic
1024150286 7:46564716-46564738 TGTAATGGCAAGTACAGTGCAGG - Intergenic
1025108473 7:56192795-56192817 TCTAATTGCAAAAATGGAGGAGG + Intergenic
1026878395 7:73893126-73893148 TGTAACTGCAAGAATTGAGCTGG + Intergenic
1028606341 7:92660473-92660495 TGCAATGGCCAGAATAGAGTTGG + Intronic
1030566450 7:111163894-111163916 TGTAAAGACTAGAATAGATGGGG + Intronic
1035100457 7:156392062-156392084 CGTGATGTCAGGAATAGAGGGGG + Intergenic
1037047017 8:14319214-14319236 TGAAATGGCAAAAATATAGCAGG + Intronic
1037207976 8:16347873-16347895 TGGAATAGGAATAATAGAGGAGG + Intronic
1037432022 8:18823733-18823755 TGTAATTGTAAGGAGAGAGGAGG - Intronic
1037926144 8:22845581-22845603 TGGAATGGCAAGATCAGAGGAGG - Intronic
1038028933 8:23619679-23619701 TGCAATGGAAAAAATAGACGGGG - Intergenic
1039660159 8:39452639-39452661 TATGATGGCAAGAGTAGATGTGG - Intergenic
1040970051 8:53125933-53125955 TGTAATGGCAATAAAAATGGTGG - Intergenic
1042007197 8:64194246-64194268 TGAACTGGAAAGAATGGAGGTGG - Intergenic
1042324605 8:67515672-67515694 GCTGATGGCAAGATTAGAGGAGG - Intronic
1043360018 8:79461215-79461237 TCTAATGGCTAGAAAAGAGGTGG + Intergenic
1044181544 8:89201815-89201837 TCTACAGCCAAGAATAGAGGAGG - Intergenic
1046201355 8:110932350-110932372 TGAAATGGCAAGAAAAGACTTGG - Intergenic
1046456601 8:114473034-114473056 TGTCATTGCAAGAAAAGAGTTGG + Intergenic
1046926665 8:119798288-119798310 TGTAATTGAAATATTAGAGGGGG - Intronic
1048775501 8:137941606-137941628 TGGAATGGAAAGAATACAGAGGG - Intergenic
1048961760 8:139585465-139585487 TGAAATAGGGAGAATAGAGGCGG + Intergenic
1049250798 8:141588053-141588075 TGTAATTACACGAATATAGGGGG - Intergenic
1050289399 9:4138514-4138536 TTTAATGGCAGGAGGAGAGGGGG + Intronic
1051041403 9:12816811-12816833 TGTAAGGACCAGAGTAGAGGAGG + Intronic
1056474450 9:86939976-86939998 TGACATGGCAAGCATAGAAGAGG - Intergenic
1056738829 9:89235111-89235133 TGAAAAGGGAAGAAGAGAGGCGG + Intergenic
1058819031 9:108712186-108712208 TCTAATAGCAAGCACAGAGGGGG + Intergenic
1059977893 9:119737272-119737294 TGTAAAGGCAGGAGTGGAGGAGG - Intergenic
1060078805 9:120621338-120621360 TATAATGGAAAGAACAGAGCAGG - Intronic
1060752587 9:126183120-126183142 TGTGGTGGGAAGAATAGAGATGG + Intergenic
1060858536 9:126934833-126934855 TGAACTGGAAAGAAGAGAGGAGG - Intronic
1061524774 9:131150386-131150408 TGTAATGGCTGGAATTGGGGAGG + Exonic
1186591390 X:10933645-10933667 TGCAATGGCTTGAAAAGAGGAGG - Intergenic
1187276807 X:17823544-17823566 TGTAAGGTCAAGAGCAGAGGTGG + Intronic
1190177883 X:48166716-48166738 TGTAATGCCAACAATTTAGGAGG - Intergenic
1191908290 X:66119431-66119453 GGTAATGGCAGGAGTGGAGGTGG + Intergenic
1193535403 X:82709466-82709488 TGCAATGGCAAGAAACAAGGAGG + Intergenic
1194234646 X:91367214-91367236 TGTAATGGTATTAAGAGAGGAGG - Intergenic
1194888134 X:99344503-99344525 TGGAATGGAAAGAAAAGAGCTGG - Intergenic
1197114007 X:122810391-122810413 TGGAATGGAAAGTATGGAGGTGG - Intergenic
1199099524 X:143782237-143782259 TGTTGTTGCAAGAGTAGAGGAGG + Intergenic
1199492580 X:148417248-148417270 TATAATGGCAAGAAGGTAGGAGG + Intergenic
1202345092 Y:23913924-23913946 TGTAATGTCAGGTATTGAGGAGG + Intergenic
1202346443 Y:23933021-23933043 TATAATTGAAAGAATACAGGGGG - Intergenic
1202524328 Y:25737072-25737094 TATAATTGAAAGAATACAGGGGG + Intergenic
1202525678 Y:25756160-25756182 TGTAATGTCAGGTATTGAGGAGG - Intergenic