ID: 1125322595

View in Genome Browser
Species Human (GRCh38)
Location 15:38504531-38504553
Sequence CAATAGGATAAGATGTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 218}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125322595_1125322599 -10 Left 1125322595 15:38504531-38504553 CCACTCCACATCTTATCCTATTG 0: 1
1: 0
2: 6
3: 34
4: 218
Right 1125322599 15:38504544-38504566 TATCCTATTGGAAGGTCTTTAGG 0: 1
1: 0
2: 12
3: 124
4: 680
1125322595_1125322603 7 Left 1125322595 15:38504531-38504553 CCACTCCACATCTTATCCTATTG 0: 1
1: 0
2: 6
3: 34
4: 218
Right 1125322603 15:38504561-38504583 TTTAGGGGCAATAACATGCATGG 0: 8
1: 80
2: 231
3: 384
4: 525
1125322595_1125322604 23 Left 1125322595 15:38504531-38504553 CCACTCCACATCTTATCCTATTG 0: 1
1: 0
2: 6
3: 34
4: 218
Right 1125322604 15:38504577-38504599 TGCATGGAGCTGTCACCTTCTGG 0: 1
1: 0
2: 2
3: 29
4: 236
1125322595_1125322601 -8 Left 1125322595 15:38504531-38504553 CCACTCCACATCTTATCCTATTG 0: 1
1: 0
2: 6
3: 34
4: 218
Right 1125322601 15:38504546-38504568 TCCTATTGGAAGGTCTTTAGGGG 0: 1
1: 0
2: 56
3: 327
4: 555
1125322595_1125322600 -9 Left 1125322595 15:38504531-38504553 CCACTCCACATCTTATCCTATTG 0: 1
1: 0
2: 6
3: 34
4: 218
Right 1125322600 15:38504545-38504567 ATCCTATTGGAAGGTCTTTAGGG 0: 1
1: 0
2: 11
3: 119
4: 595
1125322595_1125322605 26 Left 1125322595 15:38504531-38504553 CCACTCCACATCTTATCCTATTG 0: 1
1: 0
2: 6
3: 34
4: 218
Right 1125322605 15:38504580-38504602 ATGGAGCTGTCACCTTCTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125322595 Original CRISPR CAATAGGATAAGATGTGGAG TGG (reversed) Intronic
900362693 1:2297593-2297615 CAATAGGCAACGCTGTGGAGTGG - Intronic
900882484 1:5392124-5392146 CATAAGGATAAGATGCGTAGGGG + Intergenic
902542856 1:17166774-17166796 CAATAGCCTGAGATGTGGATGGG + Intergenic
903160664 1:21486862-21486884 CAATAATAAAAGATGTTGAGGGG - Intergenic
904047203 1:27615891-27615913 GGATAGGATAAGGAGTGGAGGGG - Intronic
905183664 1:36181136-36181158 CAATGGGAATAGATGTTGAGTGG - Intergenic
905676242 1:39827324-39827346 TGATAAGATAAGATGGGGAGGGG + Intergenic
906776572 1:48535119-48535141 CAAGGGGATAAGTTGTGCAGAGG + Intronic
908680541 1:66656210-66656232 CAGTGGGATAAAAGGTGGAGGGG - Intronic
908806070 1:67934095-67934117 CAGTGGGACAAAATGTGGAGGGG + Intergenic
910719667 1:90272268-90272290 CAACATAATAAGATGTGGAGAGG - Intergenic
911139363 1:94482089-94482111 CCATAGGCTTAGGTGTGGAGAGG + Intronic
911439158 1:97903927-97903949 AAATAGGAGAAGATGGAGAGGGG + Intronic
912223867 1:107708955-107708977 CAATAGGATAGGGTGTGTGGGGG - Intronic
912259721 1:108098304-108098326 CAAGAGGATCTGTTGTGGAGTGG + Intergenic
912362763 1:109108563-109108585 ATATAGGAGAAGGTGTGGAGTGG + Intronic
913678172 1:121162463-121162485 TAATAGGAAAAGATGTGTACAGG + Intergenic
914030012 1:143950092-143950114 TAATAGGAAAAGATGTGTACAGG + Intronic
914159437 1:145117858-145117880 TAATAGGAAAAGATGTGTACAGG - Intergenic
915034155 1:152908633-152908655 CAACAGCATACGATGTGGTGGGG + Intronic
915506957 1:156363737-156363759 CAGTGTGACAAGATGTGGAGGGG - Intronic
915955965 1:160220170-160220192 CAATAGGCTGATATGTGGAATGG - Intronic
917182311 1:172312800-172312822 CAATATGATAAGATCTACAGTGG + Intronic
917830883 1:178884459-178884481 TAATCTGATAAGATGTGAAGTGG + Intronic
918818001 1:189214860-189214882 CAATGGGACAAGATGTGGAGGGG + Intergenic
920153352 1:203927693-203927715 CAGGAGGACAAGATGTGGAAGGG - Intergenic
920465477 1:206180977-206180999 TAATAGGAAAAGATGTGTACAGG + Intergenic
923162168 1:231323965-231323987 GCATAGGGTAAGATCTGGAGGGG + Intergenic
924111269 1:240702256-240702278 CAAAAGAAGAAGATGTGGACAGG + Intergenic
1062794822 10:336762-336784 CAGTGGGACAAGAGGTGGAGGGG + Intronic
1063837826 10:10035782-10035804 CAAGAGGATAAGAAGTGGTGAGG - Intergenic
1064098766 10:12444908-12444930 GAACAGGAAAAGATGTGGAAAGG + Intronic
1065255099 10:23858019-23858041 CAAGAGGATCAGATATGGAAGGG + Intronic
1065448124 10:25823953-25823975 CAATAGCAAAAGGTGTGGATTGG - Intergenic
1065450385 10:25850287-25850309 CAATAGCTCAAGATGTGAAGAGG + Intergenic
1065521080 10:26573348-26573370 CAATATGAAAGGATGTAGAGTGG - Intergenic
1065530093 10:26660623-26660645 CAATATGAAAGGATGTGGAGTGG - Intergenic
1065545537 10:26816492-26816514 CCAAAGGATAAAATGTTGAGAGG + Intronic
1065556868 10:26924537-26924559 CAATATGAAAGGATGTGGAGTGG + Intergenic
1065887983 10:30095484-30095506 CAATGGGATAAGATGAAAAGTGG - Intronic
1066007931 10:31165327-31165349 CAACTGGGTAAGATGTGCAGTGG + Intergenic
1068152690 10:53154330-53154352 CAGTGGGACAAGATGTGGAGGGG + Intergenic
1071342005 10:84658042-84658064 CAAGAGAATGAGAGGTGGAGGGG - Intergenic
1076934065 10:133555764-133555786 CCACAGTGTAAGATGTGGAGGGG - Exonic
1078475991 11:11630647-11630669 AAAAAGGATCAGATTTGGAGGGG - Intergenic
1079525778 11:21385936-21385958 AAATAGGAAAAGATGGGGACTGG - Intronic
1080721511 11:34853770-34853792 CAATAGAATAAAATGTTGGGCGG - Intronic
1081603919 11:44514944-44514966 CATGAGGATAAAAGGTGGAGGGG + Intergenic
1082956729 11:58877753-58877775 CAATTAGATAAGATTAGGAGGGG + Intronic
1083072912 11:60005167-60005189 CAGTGGGACAATATGTGGAGAGG + Intergenic
1085796379 11:79543833-79543855 AAATAAGACAAGATGTTGAGAGG + Intergenic
1086088142 11:82977478-82977500 CAAGAGGCAAAGATGTGGAGAGG - Exonic
1086670181 11:89536803-89536825 CAAGAAAATAAGATTTGGAGAGG + Intergenic
1087114114 11:94505337-94505359 CAGCAGGACAAGATGTGGAGGGG + Intergenic
1087333916 11:96818635-96818657 CAGAAGGAGAGGATGTGGAGAGG + Intergenic
1088381153 11:109194164-109194186 CAGTAGCATAAGATGTGTACAGG - Intergenic
1089938246 11:122387960-122387982 CAATTGGCTATGATGGGGAGGGG + Intergenic
1091593653 12:1860340-1860362 CACTAGGATGAGGTGTGTAGGGG - Intronic
1091632391 12:2171770-2171792 AACTAGGATAACAGGTGGAGAGG + Intronic
1092069622 12:5622134-5622156 GATCAGGATGAGATGTGGAGTGG + Intronic
1092634311 12:10425087-10425109 CAGTGGGACAAGATGTGGAGGGG - Intronic
1092635357 12:10440492-10440514 CAGTGGGACAAGATGTGGAGGGG - Intronic
1092688176 12:11074397-11074419 CATTAGGAGGGGATGTGGAGAGG - Intronic
1093009367 12:14089001-14089023 CAATAACATATAATGTGGAGGGG + Intergenic
1093221955 12:16432377-16432399 CAATAAGTTAGGATTTGGAGTGG + Intronic
1097398996 12:59107076-59107098 TAATAGTATACGATGTGGAATGG + Intergenic
1099728696 12:86468982-86469004 AAATTGGATAATATGTGAAGAGG - Intronic
1101237269 12:102802370-102802392 CAGTAGCATAAGACGTGGAAGGG + Intergenic
1102940437 12:116936788-116936810 CAGAAGGATAAGAGGAGGAGAGG + Intronic
1104336792 12:127904638-127904660 CAAAAGGAGAAGATGAAGAGGGG + Intergenic
1106633871 13:31506481-31506503 CTATAGGCAAAGATGTGGATGGG + Intergenic
1107246816 13:38306773-38306795 AACTAGGATAAGATCTGAAGAGG - Intergenic
1108009620 13:45991829-45991851 AATTAGGATATGATGTGGTGTGG + Intronic
1108441006 13:50452743-50452765 CAATAGGCTAAGATATTTAGTGG + Intronic
1109184800 13:59255181-59255203 AAATAGGGTCAGATGTGGAAGGG - Intergenic
1109855539 13:68122405-68122427 AAATAGGGAAACATGTGGAGAGG - Intergenic
1111291731 13:86180036-86180058 CAGTAGGGTAAGATGTGGAGGGG + Intergenic
1112924043 13:104651183-104651205 CCATAGACTAAGATGTGGTGGGG - Intergenic
1113137068 13:107102873-107102895 CAGTAGGACAGGATGTGGAAGGG + Intergenic
1114856869 14:26457832-26457854 CAGTAGGACAAGATGTGGACAGG + Intronic
1116224431 14:42131025-42131047 CAATAAGATAAGATGAGTAATGG + Intergenic
1116590518 14:46765562-46765584 TAGTGGGACAAGATGTGGAGTGG - Intergenic
1117669449 14:58091674-58091696 CAACAGGATAAGAAGTGGTGTGG + Intronic
1118770371 14:68938892-68938914 CAAGAGGAGGAGATGGGGAGGGG + Intronic
1119551444 14:75516840-75516862 CAATATGATATGAGGTCGAGGGG - Intergenic
1119562118 14:75598870-75598892 AAATAGGAAAAGGTGGGGAGCGG - Intronic
1119580689 14:75777136-75777158 TAATTGGCTAAGATATGGAGAGG - Intronic
1120823600 14:88935337-88935359 CAATGGGACAAGACGGGGAGGGG - Intergenic
1120854806 14:89203217-89203239 CAATAGGTAGAGATGTTGAGGGG + Intronic
1121473861 14:94175607-94175629 GAAAAGGACAAGATCTGGAGTGG - Intronic
1125322595 15:38504531-38504553 CAATAGGATAAGATGTGGAGTGG - Intronic
1125436765 15:39654023-39654045 CAGTGGGACAAGATGTAGAGTGG - Intronic
1125444156 15:39735912-39735934 CAGTGGGACAAGATATGGAGTGG - Intronic
1125698975 15:41663256-41663278 CAACAAAATAAGTTGTGGAGGGG - Intronic
1127645039 15:60949541-60949563 CAATTGGAGCAGAAGTGGAGAGG - Intronic
1127680998 15:61298339-61298361 CAAAAGGAAAAGATGTTGATTGG + Intergenic
1129199759 15:73991948-73991970 GAAAGGGATACGATGTGGAGAGG - Intronic
1131758442 15:95592689-95592711 CAGTAGGAGAAGCTGTGGAAAGG - Intergenic
1133639893 16:7706675-7706697 AAATAGGATATGAAGTGCAGAGG - Intronic
1135790330 16:25388390-25388412 AAATGGGAAAAGATGTGGAATGG + Intergenic
1137306402 16:47204996-47205018 AATTAGGAAAAGATTTGGAGAGG - Intronic
1137839447 16:51626558-51626580 AAATAAGATGACATGTGGAGTGG - Intergenic
1141218636 16:82048242-82048264 CTATAGGATAGGAGGTGGAAGGG + Intronic
1143577694 17:7804223-7804245 GAATAGGACAGGGTGTGGAGAGG - Intronic
1150745857 17:67816036-67816058 GAATAGGATAAGAGGTGGGTGGG + Intergenic
1151393250 17:73801968-73801990 CAAGAGGAAAAGATGAGGAGAGG - Intergenic
1152776725 17:82206514-82206536 CAAGAGGACAGGGTGTGGAGAGG + Intronic
1154292857 18:13125644-13125666 CAATTGGATATTATGTGGAGTGG + Intergenic
1154512870 18:15127297-15127319 TAAGAGGATAGGATGTGGTGTGG - Intergenic
1154959618 18:21295301-21295323 CTTTAGGTTAAGATGTGGAGAGG - Intronic
1155103573 18:22638705-22638727 CAACAGGATAACCTGTGGAGAGG + Intergenic
1155244857 18:23897658-23897680 CACCTGGATAAGAAGTGGAGTGG - Intronic
1156036697 18:32772441-32772463 GAATAGGAAAAGATGGGGCGGGG - Intronic
1156517194 18:37690341-37690363 CAGTAGGACAAGATGTGGAGGGG + Intergenic
1156570608 18:38248189-38248211 CATAGGGACAAGATGTGGAGGGG + Intergenic
1156973358 18:43185079-43185101 AAATTGGATAATATGTTGAGGGG - Intergenic
1160750909 19:734035-734057 CAAGAGGATAGGATGAGAAGCGG + Intronic
1165596828 19:37016221-37016243 CAATAAGAAAGGATGTGCAGAGG - Intronic
929691389 2:44076861-44076883 CAAGAGGACAAGAGATGGAGGGG + Intergenic
930884978 2:56314993-56315015 CAATAGAAGCAGATGTGGGGAGG - Intronic
933320636 2:80771732-80771754 CAATAAGATAAGGGGTGGGGGGG - Intergenic
936695878 2:114947912-114947934 CAAAAAGATAAGGTGGGGAGGGG - Intronic
937028220 2:118716943-118716965 CATTAGGAGAAGGTGGGGAGGGG - Intergenic
937476342 2:122218649-122218671 CAATAGCATCACATATGGAGGGG + Intergenic
938513123 2:131971935-131971957 TAAGAGGATAGGATGTGGTGTGG - Intergenic
941875851 2:170432271-170432293 CAGTGGGATAAGATGTGTGGAGG + Intronic
942819168 2:180090606-180090628 CAGTGGGATAAGATGTGAAGGGG + Intergenic
942853240 2:180516069-180516091 AAATGGGATAAGATGAGGGGAGG - Intergenic
943348587 2:186771039-186771061 CAATAGCCTAAAATGTGGTGAGG + Intergenic
944317522 2:198299096-198299118 CAGTGGGAGAAGATATGGAGGGG + Intronic
944986114 2:205179025-205179047 CAGTGGGATAAGATATGAAGGGG + Intronic
947670550 2:231932944-231932966 AAAGGGGATAACATGTGGAGAGG + Intergenic
1171355015 20:24537205-24537227 CAACAGGTTAAGCTGTGCAGGGG - Intronic
1172105111 20:32512203-32512225 CAATATGATAAGGAGTGGTGGGG - Intronic
1172517296 20:35543697-35543719 CTATAGGACTGGATGTGGAGTGG + Intronic
1174673575 20:52331643-52331665 CAATAGGAAAAGAAGAGGATAGG + Intergenic
1175272197 20:57742230-57742252 CAGAAGGATGAGATGTTGAGTGG + Intergenic
1176780654 21:13190902-13190924 TAAGAGGATAGGATGTGGTGTGG + Intergenic
1177978333 21:27880017-27880039 TAAGAGGATAGGATGTGGTGTGG + Intergenic
1182360724 22:29744920-29744942 CAATAGGATCAGATCATGAGGGG - Intronic
1183807052 22:40220397-40220419 CAATGGGGTGGGATGTGGAGGGG - Intronic
949096163 3:88350-88372 GAGTAGGAAAAGGTGTGGAGAGG + Intergenic
950729153 3:14941689-14941711 CTTAAGGATAAGAGGTGGAGGGG - Intergenic
950779421 3:15378547-15378569 CAAAAAGATAGGATGTGCAGCGG + Intergenic
951460822 3:22949852-22949874 TGATAGGATAGGATGTGGATAGG - Intergenic
952190189 3:31014794-31014816 AAACAGTAGAAGATGTGGAGGGG - Intergenic
952483779 3:33788967-33788989 CAATAGGATAAATTGTTGTGTGG + Intergenic
953113385 3:39966511-39966533 AATTAGGATAAGGTGTGGAGGGG + Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
957640058 3:82841818-82841840 CAAGAAGATATGATGTGGAAAGG + Intergenic
958103068 3:89037897-89037919 CAATAAGATGGGAAGTGGAGAGG + Intergenic
958639520 3:96787070-96787092 CATTAGGATCAGATGAGGTGAGG - Intergenic
959884624 3:111485059-111485081 TAATAGGAATAAATGTGGAGAGG - Intronic
959961052 3:112298430-112298452 CAATAGCATTATATGTGGAGGGG - Intergenic
960135928 3:114104933-114104955 CAGTGGGACAAGCTGTGGAGGGG + Intergenic
961048718 3:123728053-123728075 CAAGAAGATAGGATGTGGAATGG + Intronic
965164580 3:165179970-165179992 AAATAGGGTAAGATGTGGTGTGG - Intergenic
965569503 3:170157326-170157348 ACATAGGATAAGATGTGGAGGGG + Intronic
967808567 3:193736294-193736316 CAGTAGGATCTAATGTGGAGGGG + Intergenic
969014866 4:4097316-4097338 TAAAAGAAAAAGATGTGGAGAGG + Intergenic
969326175 4:6445406-6445428 CAAAAGGATAAGATGTCAAATGG + Intronic
975315510 4:72947802-72947824 CTATAAGATAAAATGTTGAGTGG - Intergenic
975956672 4:79848930-79848952 CAATAGGATATGATGTTAAGTGG + Intergenic
976367723 4:84248567-84248589 CACCAGGAAAATATGTGGAGGGG + Intergenic
977392511 4:96429542-96429564 ACATAGGATAAGATTTGGAAGGG + Intergenic
978056851 4:104280645-104280667 GAATAGGAAAAGATGGGGAGAGG - Intergenic
978180315 4:105786793-105786815 CAATACTATCAGATGTGGAGTGG - Intronic
979452444 4:120888086-120888108 CAATAGGATAAAATGTCGGCCGG - Intronic
979504030 4:121474248-121474270 CAGTGGGACAGGATGTGGAGGGG - Intergenic
979674313 4:123395222-123395244 CAATATGATAAAACCTGGAGAGG - Intergenic
983509744 4:168595153-168595175 CATGAGGATAAGTTGTGGTGGGG + Intronic
983616460 4:169711152-169711174 CAATAGTATAAAATGTGGACGGG - Intronic
985217989 4:187673279-187673301 CTATAGGGTAAGAGGTGGAGAGG + Intergenic
985275116 4:188230904-188230926 CACAAGGCAAAGATGTGGAGGGG - Intergenic
987725037 5:21687232-21687254 CAATGGGACAAGATGTGGAGGGG + Intergenic
990357282 5:54981901-54981923 GAGTAGAATAAGATGTGGATTGG - Intronic
990904145 5:60785264-60785286 AAATTAGATTAGATGTGGAGTGG - Intronic
992501006 5:77343977-77343999 CAGTGGGACAAGATGTGGAGGGG - Intronic
992712680 5:79476175-79476197 CAATTGGAAGAGATGTGGAAAGG - Intronic
994788888 5:104199319-104199341 CTTTGGGACAAGATGTGGAGAGG - Intergenic
995044570 5:107630953-107630975 CAGCAGGACAAGATGTGGAGGGG - Intronic
998073393 5:139216822-139216844 CAATAGGACAATATGAGGGGTGG + Intronic
999333451 5:150694380-150694402 CAGTAGGACAAGATATGGGGTGG - Intronic
999394814 5:151220796-151220818 CAATAGGGTAGGAAGCGGAGGGG - Intronic
1000132016 5:158309376-158309398 TAATAGGACAAGAAGTGGAGGGG - Intergenic
1000149581 5:158486370-158486392 AATTAGGATAAGAAATGGAGAGG + Intergenic
1000543283 5:162567525-162567547 TAATGGGATAAGATTTGGTGAGG + Intergenic
1001293782 5:170484845-170484867 AAATGGAAGAAGATGTGGAGAGG - Intronic
1001947880 5:175795960-175795982 CAATATGATGAGAAGTGTAGTGG + Intergenic
1003149437 6:3536431-3536453 CAATAAGAAAAGACTTGGAGGGG + Intergenic
1003298798 6:4857998-4858020 CAATGGGACAAGATGGGGCGGGG - Intronic
1004442151 6:15663669-15663691 AAATAGGAGAAGGGGTGGAGCGG - Intergenic
1005437604 6:25831870-25831892 CAATAGGGGAAAATGTGGGGAGG - Intronic
1006704362 6:36005229-36005251 CATTAGGAGAAGCTGTGGAAGGG - Intronic
1007404080 6:41623563-41623585 CAAGAGGAAAAGAGCTGGAGAGG - Intergenic
1007469470 6:42079149-42079171 CAATAGGAAAGGATTTGGTGGGG + Exonic
1007725641 6:43914141-43914163 CAATGAGATAATATGGGGAGAGG - Intergenic
1008468396 6:51855580-51855602 CAATGCTATAAGATGTGTAGAGG + Intronic
1008507172 6:52242435-52242457 GAATAGGATTAGAAGTTGAGAGG - Intronic
1009319667 6:62271620-62271642 CAGTAGGACAAGATGTAGGGTGG + Intronic
1013507234 6:110813476-110813498 CACTAGTATAACAGGTGGAGTGG + Intronic
1014142325 6:117958034-117958056 CAGTGGGACAAGATGTGGAGTGG + Intronic
1014928141 6:127299327-127299349 CAGTGGGGTAAGATGTGGAGGGG + Intronic
1015942691 6:138467606-138467628 CAGTAGGACAAGATGTGGAGGGG + Intronic
1017204811 6:151793276-151793298 CAGTGGGACAAGATGTGGAAGGG - Intronic
1018266658 6:162031392-162031414 AAAAAGGATTAGATGTTGAGAGG - Intronic
1018768526 6:166952771-166952793 GAATAGGATAAGGGGAGGAGGGG + Intronic
1019098943 6:169611769-169611791 CAGTGGGACCAGATGTGGAGGGG - Intronic
1021443813 7:20711080-20711102 CAATAGCAAAAGATTTGGAGGGG - Intronic
1021928374 7:25554846-25554868 CCATAAACTAAGATGTGGAGAGG + Intergenic
1022035140 7:26527086-26527108 CAATATGTCAAGATATGGAGAGG - Intergenic
1022045549 7:26619715-26619737 CAATAGTATTAGGTGTGGAAAGG + Intergenic
1022086569 7:27074076-27074098 CAATAGGATGAGATATTCAGAGG + Intergenic
1025730720 7:64104506-64104528 CATAAGGATAACATGTGGAAGGG + Intronic
1027644046 7:80774072-80774094 TAATCTGATAAGATGTGGAAGGG + Intronic
1030397042 7:108999004-108999026 CAATGGGAGAAGAAGTGGAAAGG - Intergenic
1030892721 7:115020082-115020104 AAATAGAAGAAGTTGTGGAGAGG + Intergenic
1031802515 7:126265714-126265736 CAACAGCATAAAATGTGGGGAGG + Intergenic
1033002682 7:137524707-137524729 TAATAGGAGAAGTTGAGGAGGGG + Intronic
1036167699 8:6452576-6452598 CAATGGGATAACATTTGGATAGG + Intronic
1036544550 8:9754308-9754330 AAATAGGGGAAGATGTGTAGAGG - Intronic
1036771828 8:11584092-11584114 CAATTGGATAAGAGTTGGAATGG + Intergenic
1037195402 8:16182673-16182695 CAGTGGGAGAAGATATGGAGGGG - Intronic
1038473671 8:27846292-27846314 CAAGAGGATAGGATGGGTAGAGG + Intergenic
1042446937 8:68895539-68895561 CAAAAGTATAGGGTGTGGAGTGG - Intergenic
1042631602 8:70822594-70822616 CAATAGGTTCAGATTTGCAGTGG + Intergenic
1042925943 8:73968752-73968774 GAATAGGTTAAGAAGTGGATGGG - Intronic
1043575716 8:81653582-81653604 CAATAGCATATGATGTTGGGGGG + Intergenic
1044734323 8:95263068-95263090 CAATAGAATAGGATTTAGAGAGG + Intronic
1046056403 8:109083943-109083965 CAATAAGAAAAGAATTGGAGTGG + Intergenic
1046890013 8:119412570-119412592 CAGTGGGACAGGATGTGGAGTGG + Intergenic
1047524459 8:125620577-125620599 GAATTGGTTAAGTTGTGGAGAGG + Intergenic
1047801418 8:128314249-128314271 CAATAGGCGAACAAGTGGAGGGG - Intergenic
1051859825 9:21611972-21611994 AAATTTGAAAAGATGTGGAGAGG - Intergenic
1052074675 9:24126454-24126476 CAATAAGATAAGGAGTTGAGGGG - Intergenic
1055183420 9:73419155-73419177 CAATGAGAAAACATGTGGAGTGG + Intergenic
1055733541 9:79304043-79304065 CCATAGGATATGATGTGAACAGG - Intergenic
1056058922 9:82862205-82862227 CAAAATGATAAGATATGGAAAGG - Intergenic
1056242514 9:84662451-84662473 CAGTGGGACAAGATGTGGAGTGG - Intergenic
1057116359 9:92526138-92526160 CAGTGGGACAAGATATGGAGGGG + Intronic
1057216599 9:93232048-93232070 CAATCGGATCAGATTGGGAGAGG + Intronic
1059494698 9:114699926-114699948 GCATAGGATAAGGGGTGGAGTGG - Intergenic
1060678422 9:125538384-125538406 CTAATGGATAAGATGTGGGGAGG + Intronic
1062539572 9:137035629-137035651 CAATGGGATGAGAGTTGGAGGGG - Exonic
1203451108 Un_GL000219v1:117651-117673 CAATGGCATTAGAAGTGGAGGGG - Intergenic
1187636624 X:21236955-21236977 CAGTTGGACAAGATCTGGAGAGG + Intergenic
1187829544 X:23366866-23366888 CAATAGAATAAGAGCTGGAAAGG - Intronic
1188145849 X:26612463-26612485 TAATTGGATGTGATGTGGAGGGG - Intergenic
1191661313 X:63654434-63654456 CATTGGGACATGATGTGGAGTGG - Intronic
1191801815 X:65089866-65089888 CAGTGGGAAAAGATGTTGAGGGG - Intergenic
1193499812 X:82261735-82261757 CAATCTGAAAAGATGGGGAGAGG + Intergenic
1193516483 X:82471986-82472008 CAAAAGAATAATATGTGGAGGGG - Intergenic
1196066078 X:111465817-111465839 CAATAGGATGAGATCTGAAGAGG - Intergenic
1197093398 X:122565744-122565766 AAATAAGATAAAATGTGTAGAGG + Intergenic
1197877945 X:131131428-131131450 CAGTGGGACAAAATGTGGAGGGG - Intergenic
1200383147 X:155860738-155860760 CAATAGGATTACTTGTGGGGAGG - Intergenic
1200938291 Y:8757537-8757559 CAATAGGGTCAGATGGGGAGAGG - Intergenic
1201964895 Y:19721345-19721367 GAGTAGGATACGATGAGGAGAGG + Intronic
1202025107 Y:20513200-20513222 CAGTGGAACAAGATGTGGAGGGG + Intergenic