ID: 1125324448

View in Genome Browser
Species Human (GRCh38)
Location 15:38522726-38522748
Sequence ATTGAGAAGTTCAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 335}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125324445_1125324448 -7 Left 1125324445 15:38522710-38522732 CCATTACATCCAGTATATTGAGA 0: 1
1: 0
2: 1
3: 11
4: 156
Right 1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG 0: 1
1: 0
2: 2
3: 31
4: 335
1125324443_1125324448 -5 Left 1125324443 15:38522708-38522730 CCCCATTACATCCAGTATATTGA 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG 0: 1
1: 0
2: 2
3: 31
4: 335
1125324444_1125324448 -6 Left 1125324444 15:38522709-38522731 CCCATTACATCCAGTATATTGAG 0: 1
1: 0
2: 1
3: 9
4: 132
Right 1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG 0: 1
1: 0
2: 2
3: 31
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125324448 Original CRISPR ATTGAGAAGTTCAGTGAGGA AGG Intronic
900921927 1:5678218-5678240 CTTGAGAAGTGGGGTGAGGAAGG + Intergenic
901945787 1:12702506-12702528 GTTGAGAAGTACATAGAGGAAGG - Intergenic
902079151 1:13809302-13809324 AGTGAGAAGTCCAGTGAGGAAGG + Intronic
902882646 1:19382937-19382959 AGAGAGAAGTCCAGTGAAGATGG - Intronic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905323643 1:37134782-37134804 ATTGAGAAGGTGTGGGAGGAGGG + Intergenic
905842855 1:41199573-41199595 ATTTAGAAGTTGAGTGACCATGG - Intronic
907178545 1:52549336-52549358 AGTGAGAAATTCAGTGTGGTAGG - Intronic
908023403 1:59921993-59922015 ATTATTAAGTTTAGTGAGGATGG - Intronic
908810749 1:67979689-67979711 ATTGTTAAGTACAGTGGGGAAGG + Intergenic
908828562 1:68156966-68156988 ATTGAGAACTTGAGGGCGGAAGG + Intronic
908968173 1:69791892-69791914 ATTGAGAAGATGAGTATGGAGGG + Intronic
910269832 1:85382074-85382096 ATTATGAAGCTTAGTGAGGAAGG + Intronic
910504787 1:87937624-87937646 AGGGGGAAGTGCAGTGAGGAAGG + Intergenic
911207692 1:95108902-95108924 TTTTAAAAGATCAGTGAGGAAGG - Intergenic
912578355 1:110696792-110696814 GTTGAGAAGTTCGGTGGGGCTGG + Intergenic
912911965 1:113770407-113770429 ATCGAGAAGTCCAGAGAGGTTGG - Intronic
913315637 1:117549050-117549072 ATTCAAAAGTTCTGTGAGGCTGG + Intergenic
915785731 1:158609376-158609398 ATTGAGAACTTCAGAGTAGATGG - Intergenic
916009595 1:160692687-160692709 ATTGAGAAGTCAAGAAAGGAAGG + Intronic
917139388 1:171819829-171819851 AAAGAGAAGTTGAGTGAGGGTGG + Intergenic
920601702 1:207331877-207331899 ATTTAGAAGATCAGTGAAGCTGG + Intronic
921523093 1:216181503-216181525 TTAGAGAAGTTCAGTGAACATGG + Intronic
921556475 1:216604279-216604301 ATCTAGAAGCTCAGTGAAGAGGG + Intronic
921616791 1:217277727-217277749 AATGAGAAGTGCAGTGTGAAGGG - Intergenic
921889625 1:220340653-220340675 AGTGAGAAGATCTGTGATGATGG + Intergenic
922170469 1:223150339-223150361 CTTGGGAAGCTGAGTGAGGAGGG - Intergenic
922624986 1:227030782-227030804 ACTGAAAAGTTCAATGAGTATGG - Intronic
924018762 1:239757752-239757774 ATTGAGCATTAAAGTGAGGAAGG - Intronic
924188622 1:241523696-241523718 AATGAGAAGTGAAGTGAAGATGG - Intergenic
924529467 1:244881143-244881165 ATTGACAAGTTGAGGGAGGAAGG + Intergenic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1063661124 10:8035784-8035806 ATTGAGAATTACACTGAGGGAGG + Intergenic
1065324180 10:24536123-24536145 CTTGTGAACTTCAGTCAGGAAGG - Intronic
1065868345 10:29933815-29933837 ATCCAGAAGATCTGTGAGGAAGG + Intergenic
1067429302 10:46232577-46232599 GTTGAGAAGTGAAGTGTGGAGGG + Intergenic
1067444437 10:46331828-46331850 GTTGAGAAGTGAAGTGTGGAGGG - Intergenic
1067658602 10:48216857-48216879 ATTGGGAAGTCCTGGGAGGAGGG - Intronic
1068691151 10:59915948-59915970 AGTGAGAAATTTAGTGAGGCTGG + Intergenic
1069027647 10:63561315-63561337 ATTTAGAAGTTTATGGAGGAAGG + Intronic
1069342892 10:67433083-67433105 ATAGTTAAGTTCAGTGAGGAAGG - Intronic
1071074705 10:81736094-81736116 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
1073358113 10:102873181-102873203 ATTGAGAAGTTGGGAGAGGCTGG + Exonic
1077450350 11:2639198-2639220 TTTGACAAGTTGAGAGAGGAAGG - Intronic
1078620667 11:12904360-12904382 ACTGAGAAGTTCACTAAGGTAGG - Intronic
1079390721 11:20019687-20019709 ATTGAGAAGCGCAGTTAGGGAGG + Intronic
1079950240 11:26793004-26793026 ATACAGAATTTCAGTGTGGAAGG - Intergenic
1080959026 11:37136122-37136144 ATTATTAAGTTCAGTGAGGGCGG - Intergenic
1081114795 11:39187203-39187225 TTTGAGAAGGGTAGTGAGGAGGG - Intergenic
1083645460 11:64169923-64169945 ATTCTAAACTTCAGTGAGGAAGG + Intergenic
1083690826 11:64407502-64407524 ACTTAGAAATTGAGTGAGGAGGG + Intergenic
1083776472 11:64896562-64896584 ATTGAGCAGTACAGGAAGGATGG - Exonic
1086957028 11:92943743-92943765 ATTATTAAGTTTAGTGAGGAGGG + Intergenic
1086957581 11:92949408-92949430 ATTATTAAGTTTAGTGAGGAGGG + Intergenic
1088193028 11:107247192-107247214 GTTGTGAAGTCCAGTGAGGTAGG + Intergenic
1089264244 11:117246920-117246942 ATTGAGAAGCTTTGTGAGAAGGG + Exonic
1090926660 11:131256151-131256173 AATGAGAAGTTCTGAGAGGTGGG + Intergenic
1091226730 11:133961425-133961447 ATTGGGAGGCTGAGTGAGGATGG - Intergenic
1091266185 11:134272941-134272963 CTTGAGAAGGTAAGAGAGGAGGG - Intergenic
1092192482 12:6531055-6531077 AGTGATGAGTCCAGTGAGGAAGG + Exonic
1093221881 12:16431396-16431418 ATGATTAAGTTCAGTGAGGAAGG - Intronic
1093368040 12:18328301-18328323 TTTAAGTAATTCAGTGAGGAGGG + Intronic
1093501378 12:19815647-19815669 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
1093546878 12:20359204-20359226 ATGGAGCACTCCAGTGAGGAAGG + Intergenic
1093802423 12:23389800-23389822 ATTGACAAGTTGAGAGAAGAAGG + Intergenic
1093854828 12:24088870-24088892 ATTCAGAAGGCCAGTGAAGAAGG - Intergenic
1093947743 12:25129649-25129671 ATGGAGAAGTTTAGATAGGAAGG - Intronic
1094100940 12:26761496-26761518 TTTAAAAAGTTCAGTGAGGTGGG + Intronic
1095092898 12:38123517-38123539 ATTATGAAGTTTAGTGAGGGTGG - Intergenic
1095719381 12:45384434-45384456 ATTACTAAGTTTAGTGAGGAAGG - Intronic
1096984441 12:55746791-55746813 ACTGAGAAGTTTGGTGAGTAAGG + Intronic
1097220421 12:57447044-57447066 ACTAAGATGTTCAGTAAGGAAGG + Intronic
1097247044 12:57612413-57612435 ATAGAGGAGGCCAGTGAGGAGGG - Intronic
1097452078 12:59749146-59749168 ATTGAGAATTTAAGGTAGGAAGG + Intronic
1098044347 12:66384669-66384691 AGTAAGAAGATAAGTGAGGAAGG + Intronic
1098894963 12:76048504-76048526 ATTGAGAAATTCACTGAAGCAGG - Intronic
1099035416 12:77581044-77581066 TTTGAGAAGTTAAGGGAGGCTGG + Intergenic
1099448927 12:82785247-82785269 ATTGAGAAATGCAGTCGGGAAGG + Intronic
1099936790 12:89135869-89135891 CTTGATAGGGTCAGTGAGGAGGG - Intergenic
1100951930 12:99860397-99860419 ATTTAGTAGTTTAGGGAGGAAGG + Intronic
1100963806 12:99990986-99991008 GTTGTGAAGTTTAGTGATGATGG - Intergenic
1103328037 12:120134565-120134587 ATTGAGCAGCTCTGTGAAGAGGG + Exonic
1105485236 13:20823375-20823397 CTTGAGAAGTTCAGAGATTAAGG - Intronic
1105679445 13:22710651-22710673 ATTCAGAAGGTCAGGGAGGGAGG - Intergenic
1106357586 13:28998875-28998897 TTTGACAAGTTCAGAGAAGAAGG - Intronic
1107461205 13:40605523-40605545 ATTGAGAAGTACAGTGTGGTTGG - Intronic
1107964082 13:45584149-45584171 ATGGAGAATTTCTGTGAGCATGG + Intronic
1108690444 13:52855047-52855069 TGTGAGAAGTGCTGTGAGGAAGG + Intergenic
1108712478 13:53047278-53047300 GGTGAGAAGCTCAGTGAAGATGG + Intronic
1109105241 13:58241778-58241800 ATTGTTAAGTTTAGTGAGGGCGG - Intergenic
1109125965 13:58517302-58517324 ATGACTAAGTTCAGTGAGGAAGG + Intergenic
1110195995 13:72789144-72789166 ATAAAGAAGTACAGTAAGGAAGG - Intronic
1110620172 13:77586010-77586032 ATGGAGAGTTTCAGGGAGGAGGG - Intronic
1111477409 13:88769830-88769852 ATGTAGGAGTTCAGTTAGGAAGG + Intergenic
1112456590 13:99568690-99568712 ATTGTTAAGTTTAGTGAGGGTGG + Intergenic
1112642706 13:101294660-101294682 ATTGTTAAGTTTAGTGAGGGTGG + Intronic
1112813533 13:103246970-103246992 ATTAAGCTGTTCTGTGAGGAAGG - Intergenic
1113777179 13:112954476-112954498 ATAGTGAAGTTAAATGAGGAGGG - Intronic
1113961928 13:114131053-114131075 TTTGAGTAGTCCAGAGAGGAGGG - Intronic
1114599677 14:23944245-23944267 ATTATTAAGTTTAGTGAGGATGG + Intergenic
1115300506 14:31879961-31879983 AATGAGAAGTTTATTAAGGAAGG + Intergenic
1115331493 14:32202921-32202943 AATGAAAAGTTCAATGAAGAAGG + Intergenic
1115338246 14:32263571-32263593 ATTGAGATCTTCAGTGGTGAAGG - Intergenic
1116423716 14:44764362-44764384 AGTGAGAAGTTCAGACTGGAAGG + Intergenic
1116610298 14:47061408-47061430 ATTAAGAAGTTCTGAGCGGATGG - Exonic
1116646056 14:47530583-47530605 ATTATTAAGTTTAGTGAGGATGG - Intronic
1117099882 14:52335301-52335323 ATTGAGTTGTTCAGAGAGGAGGG - Intergenic
1117552123 14:56847073-56847095 CTTTAGAAGTTCAGTGTAGAAGG + Intergenic
1117609939 14:57472633-57472655 ACTGGGAAGTTCAGTGAGTCTGG + Intronic
1118048995 14:62005436-62005458 ACTGAGAAGTACAGAGAAGAAGG - Intronic
1119489327 14:75017172-75017194 TTTGCGAAGTTTAGTGAGGTTGG + Exonic
1119944360 14:78676204-78676226 ATTAATAAGTTTAGTGAGAAAGG + Intronic
1120080361 14:80209637-80209659 ATTGTGCATGTCAGTGAGGACGG - Intronic
1120197614 14:81502740-81502762 TTTGAGAAGCTGACTGAGGAAGG - Exonic
1121867501 14:97376714-97376736 ACTGAAAAGTCCAGTGAGGCTGG - Intergenic
1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG + Intronic
1127284693 15:57522118-57522140 AATCAGAAGTTCAGTGTGGGGGG - Intronic
1128285686 15:66435148-66435170 TTTGAGAAGATCAGTGAGCTGGG + Exonic
1128748985 15:70135027-70135049 ACTGAGCAGTTCAGTGAGGCTGG - Intergenic
1129625868 15:77198883-77198905 ATTAAGAAAATCATTGAGGAAGG + Intronic
1130364576 15:83222669-83222691 TTTGAGAAGTTGAGAGAAGAAGG + Intergenic
1131833808 15:96370531-96370553 ATGGAGCAGTGCAGTGAGGTGGG - Intergenic
1132512388 16:350678-350700 ATTGAGAATTTCAGTGATGGGGG - Intronic
1133853863 16:9531197-9531219 TTTTAGAAGCTCAGTGAAGATGG + Intergenic
1133923677 16:10177703-10177725 TTTGAGAAGTCCAGGGAGTATGG - Intronic
1134049057 16:11124218-11124240 CTTGAGAATTTCAGTGTGAAGGG - Intronic
1134467782 16:14494676-14494698 ACTGAGGAGTTCAGTCAGGAGGG + Intronic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1136078191 16:27831283-27831305 ATTGAAAAGTTCAGGGATAATGG - Intronic
1139243502 16:65418515-65418537 ATTAAGGAGTTCAGAGAGAATGG - Intergenic
1141325039 16:83048897-83048919 ATAGAGATGTTGAGTGAAGATGG - Intronic
1143455587 17:7065546-7065568 CTTGAGAGCCTCAGTGAGGAGGG - Intergenic
1146713222 17:35061039-35061061 CATGAGAAGTTCAGTGAAGCTGG + Intronic
1147559593 17:41500669-41500691 ATTAGGATGTTCAGTGAGAATGG - Intergenic
1147613662 17:41815805-41815827 TTTCAGAAGTAAAGTGAGGATGG - Intronic
1149766867 17:59286358-59286380 TTTAAGAAGTTCAGTGACAAAGG - Intergenic
1150509335 17:65733041-65733063 ATTACTAAGTTCAGTAAGGAAGG - Intronic
1151001237 17:70379386-70379408 ATGGTGAAGGTCATTGAGGATGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1155469978 18:26181529-26181551 ATTGTTAAGCTTAGTGAGGAAGG + Intronic
1156253157 18:35371479-35371501 GTTGAGAAGTCCAGGGTGGAGGG + Intronic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1157092290 18:44650423-44650445 AGCGAGAAGGTCAGTGAGGGTGG + Intergenic
1157231219 18:45917796-45917818 ATTGAGAAGTTCTGTGCAGAAGG - Exonic
1157963976 18:52187639-52187661 TTTGACAAGTTTAGTGTGGATGG - Intergenic
1158631676 18:59120688-59120710 ATGGTGAATTTCAGTGAGGGTGG - Intergenic
1159042413 18:63336998-63337020 AAACAAAAGTTCAGTGAGGACGG - Intronic
1159720441 18:71883372-71883394 GAAGAGAAGTTCAGTGTGGATGG - Intergenic
1162142049 19:8591037-8591059 AGTGAGAAGTTTACTGGGGAGGG - Intronic
1162182052 19:8876616-8876638 ATGGTGAAGTTCAGTGTGAATGG + Exonic
1163187920 19:15652731-15652753 ATTGAGGACCTCAGGGAGGATGG - Intronic
1164421758 19:28099689-28099711 GTAGAGGAGTTCAGTGAAGAGGG + Intergenic
1166239595 19:41480885-41480907 CTTGAGAAGTGCTGTGATGATGG - Intergenic
1167204779 19:48093655-48093677 AATGAGAAGACCAGTGAGGCTGG - Intronic
1167564478 19:50247767-50247789 ATTAAGCAGGTCAGTGAGGCCGG + Intronic
1167626850 19:50596063-50596085 ATGATTAAGTTCAGTGAGGAAGG + Intergenic
1168367027 19:55797017-55797039 AGTGAGGAGATCAGGGAGGATGG - Intronic
926537894 2:14136054-14136076 ATGGTCAAGTTTAGTGAGGAAGG + Intergenic
927407889 2:22792944-22792966 ATTGAGGAATACAGTGAGAAAGG - Intergenic
927879904 2:26682926-26682948 AATGAGTAGCTCAGAGAGGAAGG - Intergenic
928046156 2:27934564-27934586 ATGATGAAGTTTAGTGAGGAAGG + Intronic
928661668 2:33508131-33508153 ATTGAGAAATTGAGAGTGGAGGG + Intronic
929355691 2:41021671-41021693 ATGGAGGCATTCAGTGAGGAGGG - Intergenic
931314436 2:61114569-61114591 ATGTAGGAGTTCAGTCAGGATGG - Intronic
931491576 2:62753977-62753999 ATTGACAAGTTGAGAGAAGAAGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932969458 2:76522319-76522341 AATGAGAAGTGCAGTGAACATGG + Intergenic
933400458 2:81790116-81790138 TTTGTGAACTTCAGTGGGGATGG + Intergenic
936762543 2:115804415-115804437 TTTGACAAGTTGAGAGAGGAAGG - Intronic
936936018 2:117838933-117838955 ATTGATAAAGTCAGTGAGGAAGG + Intergenic
937174047 2:119908722-119908744 ATGATTAAGTTCAGTGAGGAAGG + Intronic
937659467 2:124413959-124413981 ATTGAGAGATGGAGTGAGGAGGG + Intronic
937659668 2:124416198-124416220 ATTGAGAGTTGGAGTGAGGAGGG + Intronic
938967786 2:136403999-136404021 AGTGAAAAGTTCAGTTTGGATGG - Intergenic
940896877 2:159089449-159089471 ATTGAGAAGTAAAGAGAAGAGGG - Intronic
940903249 2:159146204-159146226 AGTGAGAAGTTCAGTGAGAGAGG + Intronic
941651200 2:168094362-168094384 ATTCAAAAGTTCAGTGTGGAGGG - Intronic
941781911 2:169453922-169453944 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
942067511 2:172285442-172285464 TTTGAGAAGGTCAGTGAGTGCGG + Intergenic
942310340 2:174650572-174650594 ATGGAGAAGAACAGTCAGGATGG - Intronic
942411854 2:175717726-175717748 ATTGAGAAGTTGAGAGAAGAAGG + Intergenic
943263730 2:185698670-185698692 ATTCAGAGGTTCAGTGATTAAGG + Intergenic
944162022 2:196672733-196672755 ATTCAGAAGTTCACTTTGGAGGG - Intronic
944561722 2:200945973-200945995 AGTGAGGAGTTCAGTCAGGCTGG - Intronic
945362708 2:208910880-208910902 ATTGTGGGGTTCAGTCAGGATGG + Intergenic
946868683 2:224066272-224066294 ATTGAGAAGGTCTGTCAGGATGG + Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948529303 2:238593910-238593932 GATGAGACGTTCAGTGAGGAGGG + Intergenic
948675815 2:239595944-239595966 AGTGAGGAGTTCAGTGATGGAGG + Intergenic
948766074 2:240219780-240219802 AGCGAGGAGTTCAGGGAGGATGG - Intergenic
1169546169 20:6653156-6653178 CTTGAGGAGTGCTGTGAGGATGG + Intergenic
1173813183 20:45968651-45968673 TTTGAGAAGTTTGGAGAGGAAGG - Intronic
1175087102 20:56468758-56468780 GTTGAGAAGGTCAGTGATGTGGG + Exonic
1177475805 21:21620469-21620491 ATTGAGAGTTCCAGAGAGGAGGG + Intergenic
1178525628 21:33325898-33325920 ATTGACATGGTCAGTGTGGAAGG + Intronic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG + Intronic
1184246154 22:43236737-43236759 ATAGAGAAGTTCAGTATGGCAGG - Intronic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
949148645 3:736634-736656 AATGAGAGGTTCGGTGATGAAGG + Intergenic
951271637 3:20632047-20632069 GAAGAGAAGTTCAATGAGGAGGG - Intergenic
953972149 3:47355986-47356008 ATTGAGAAGAACAGCCAGGACGG - Intergenic
954942813 3:54390574-54390596 ATAGAGGAGTTCACTGAGGTCGG - Intronic
955203590 3:56875299-56875321 AATCAGAATTTCAGGGAGGAAGG - Intronic
955630191 3:60965423-60965445 TTTGACAAGTTGAGTGAAGAAGG - Intronic
956180525 3:66513882-66513904 AATAAGAAGTTTAGTGAGGAAGG - Intergenic
956926264 3:73991851-73991873 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
958253045 3:91292275-91292297 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
958850333 3:99317427-99317449 ATTAAAAAGTTCAGTGTGGCAGG - Intergenic
958914304 3:100031396-100031418 TTTGGGAAGTGGAGTGAGGAAGG + Intronic
959218436 3:103483157-103483179 TTTGACAAGTTGAGAGAGGAAGG - Intergenic
959887601 3:111520480-111520502 TTTGTGAAAATCAGTGAGGAAGG - Intronic
960236635 3:115290663-115290685 TTTGAATAGTTCAATGAGGAGGG + Intergenic
960589246 3:119349685-119349707 ATTGAAGAGGTCAGGGAGGAGGG - Intronic
960956486 3:123035128-123035150 CTGGAGAAGTTCAGTGGAGAGGG + Intergenic
961189975 3:124951807-124951829 ATAGAGAAGTTAAGTAACGAAGG + Intronic
964040434 3:152254889-152254911 ATATAGAAGTTCAGAGAGGTAGG + Intronic
964310321 3:155385320-155385342 AGTGGGAAGTTCAGTGTTGATGG - Intronic
964892190 3:161550740-161550762 ATTGAGAAGGTCTGTGAGCAGGG - Intergenic
965386330 3:168050465-168050487 TTTGAGAATTTCACTGAGGTGGG + Intronic
966380476 3:179339585-179339607 ATTAAGAATTTAAGTGAGGCTGG + Intergenic
966535480 3:181028396-181028418 ATTCTGAAGATCAGTGAGGTTGG + Intergenic
966715663 3:183010999-183011021 AGTGAGAAGTTGATTGTGGAGGG + Intergenic
967267291 3:187701943-187701965 GGTGAGAGGTTCAGTGGGGAGGG - Exonic
967325816 3:188238454-188238476 ATGGTTAAGTTTAGTGAGGAAGG - Intronic
969930921 4:10629742-10629764 AGTGTGAAGTTCAGGGGGGAAGG + Intronic
970456521 4:16227918-16227940 ATAGAGAATTTCATGGAGGATGG - Intergenic
970479946 4:16462632-16462654 ATTGATACTTTCAGTGGGGAAGG - Intergenic
971258188 4:25032108-25032130 ATTGACAAGATCCATGAGGACGG + Intergenic
971810151 4:31414428-31414450 ATTGAGAAAGTGAGAGAGGAAGG - Intergenic
973683604 4:53346760-53346782 GAAGAGCAGTTCAGTGAGGATGG + Intronic
973933734 4:55819885-55819907 AATGAGAAGTTAAGAGAGGGAGG + Intergenic
974087381 4:57275987-57276009 AGTGAAAAGTTGAGTGAGGATGG - Intergenic
975255975 4:72235854-72235876 TTTGACAAGTTGAGAGAGGAAGG - Intergenic
975988692 4:80233608-80233630 AGTAAGTAGTTCAGTGAGAAAGG - Intergenic
976114704 4:81714514-81714536 ATTGAAAAGTTAATTGAAGACGG - Intronic
976518967 4:86004458-86004480 ATTGTCAATTTCAGTGATGATGG + Intergenic
976652511 4:87451236-87451258 ATTGAGGAGGTCAGTGTGGCTGG + Intronic
976878773 4:89891953-89891975 ATTGAGGAGTTCACTGTAGATGG - Intronic
977215255 4:94274972-94274994 ATTGAGAAATTTGGGGAGGATGG + Intronic
977272987 4:94940998-94941020 ATTGGGAATTTCAATGAGGAAGG + Intronic
977653292 4:99493271-99493293 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
978106654 4:104910808-104910830 ATTGATATTTTCAGAGAGGAAGG - Intergenic
978327575 4:107576533-107576555 AAAGAGCAGTTCAGTGAAGAGGG - Intergenic
979634738 4:122944620-122944642 TTTGACAAGTTGAGAGAGGAAGG - Intronic
979645619 4:123064300-123064322 AGTGAGACGTTGAGGGAGGAAGG + Intronic
979778150 4:124616920-124616942 TTTGACAAGTTGAGAGAGGAAGG - Intergenic
981551863 4:145949850-145949872 GTTGAGCAGGACAGTGAGGAGGG + Intergenic
982021731 4:151211487-151211509 ATGGTTAAGTTTAGTGAGGAAGG + Intronic
983091271 4:163505614-163505636 GGTGAGAAGTTCAGTAAGAATGG + Intronic
984479138 4:180276529-180276551 ATGACGAAGCTCAGTGAGGAAGG + Intergenic
985104391 4:186486658-186486680 TTTTAGAAGTGCTGTGAGGATGG + Intronic
985149040 4:186927684-186927706 ATTCAGGAGGTCAGAGAGGAGGG + Intergenic
985345886 4:189003599-189003621 ATTGTTAAGCTTAGTGAGGAAGG + Intergenic
988000928 5:25347385-25347407 ATTGAGTAGTTCAGGGTGAATGG - Intergenic
989056283 5:37368929-37368951 ATCGATAACTTTAGTGAGGATGG + Intronic
990042664 5:51391509-51391531 ATTGAAAGATTCAGTGGGGAGGG + Intronic
991442903 5:66669765-66669787 AGTGAGAAGTACAGTGAGGGTGG + Intronic
992438259 5:76775804-76775826 ATTGAAAAGGTCAGTGTGGCTGG - Intergenic
993547250 5:89228972-89228994 TTTAAGAAGTTCAGTTAGGCTGG - Intergenic
993906832 5:93632659-93632681 ATTGGTAAGTGCAGTCAGGAAGG - Intronic
994036857 5:95211659-95211681 TTTGACAAGTTGAGTGAAGAAGG - Intronic
994242226 5:97437328-97437350 ATTTAGAAGTTCATTGAGTAAGG - Intergenic
994258057 5:97623847-97623869 ATTTAAAAGTTCAGTGATAATGG + Intergenic
994898288 5:105734938-105734960 ACTGAAGACTTCAGTGAGGAAGG + Intergenic
995516181 5:112956154-112956176 AATCAGAACTTCAGTAAGGAGGG + Intergenic
997894081 5:137700257-137700279 ATTAAAAAGTTCATTGATGAGGG + Intronic
998314002 5:141163065-141163087 AGAGAGAAATTCAGTAAGGATGG + Intergenic
998325271 5:141274656-141274678 ATTAAGAAATCCAGTGAGGCCGG + Intergenic
1000373279 5:160557216-160557238 CTTTGGAAGTTCAGTGAGTAGGG + Intergenic
1001031779 5:168268627-168268649 GGTGAGAAGTTCAGAGAGGCCGG + Intergenic
1001289446 5:170446268-170446290 ATTGAGTAGTGCAGTGAGACTGG + Intronic
1002209540 5:177589005-177589027 ATGTAGAGGTTCAGTCAGGATGG - Intergenic
1002881744 6:1258493-1258515 ATGATGAAGTTTAGTGAGGAAGG + Intergenic
1003594735 6:7464165-7464187 ACTGAGAACTCCAGGGAGGATGG + Intergenic
1003594913 6:7465840-7465862 ACTGAGAACTCCAGGGAGGATGG + Intergenic
1005065446 6:21813553-21813575 ATCGACAAGTTCAGTCAGGTGGG - Intergenic
1006027103 6:31154169-31154191 ATTGTGGAGGGCAGTGAGGAAGG - Intronic
1006448281 6:34091882-34091904 ATCCAGAAGTCCCGTGAGGACGG - Exonic
1008271058 6:49490635-49490657 ATTACTAAGTTTAGTGAGGAAGG - Intronic
1008678160 6:53843790-53843812 ACAGAGCAGTTCAGTGAGGAGGG - Intronic
1009191445 6:60634772-60634794 TTTGACAAGTTGAGAGAGGAAGG - Intergenic
1009461082 6:63914274-63914296 ATGATGAAGTTTAGTGAGGAAGG + Intronic
1010452869 6:76022149-76022171 ATCGAGAATTTCATTGAGGAGGG + Exonic
1010836913 6:80599612-80599634 ATTAAGAAATTCATTGAGAAGGG + Intergenic
1010920081 6:81670152-81670174 TTTGAGAAAATCAGTAAGGATGG - Intronic
1012152362 6:95770245-95770267 GTAGAGAAGTTCAGAGAGTAGGG - Intergenic
1013314577 6:108929329-108929351 ATTGACAAAATCAGTGAGAAAGG - Intronic
1013421379 6:109970156-109970178 GTTGAGAAGAGCAGTGAGAAAGG - Intergenic
1014828237 6:126070976-126070998 AAAGAAAAGGTCAGTGAGGAAGG + Intergenic
1016152210 6:140755503-140755525 ATTGAGAATTTCAGAGAGGGTGG - Intergenic
1016478022 6:144449775-144449797 ATCGAGAAGCTCTGTGGGGAGGG + Intronic
1016564117 6:145433274-145433296 ATTATTAAGTTTAGTGAGGAAGG - Intergenic
1017734692 6:157350623-157350645 ATGGTTAAGCTCAGTGAGGAAGG + Intergenic
1017942556 6:159065919-159065941 ATTAAGAAGTTGAGTGGGGGTGG + Intergenic
1020441160 7:8218300-8218322 ATGGAGAAGTTCAGGAAGGTAGG - Exonic
1020617266 7:10475439-10475461 TTTGAGAAGTTCAGTAAGAAGGG - Intergenic
1021225134 7:18017868-18017890 ATAAAGAAGTTCAGTGTGGCTGG - Intergenic
1021652919 7:22848961-22848983 AATAAGCAGTTCATTGAGGAAGG + Intergenic
1021942917 7:25697015-25697037 AATGTGAAGTTTAGTCAGGAGGG - Intergenic
1022685389 7:32591505-32591527 ACTGTGAAGGCCAGTGAGGAAGG - Intergenic
1023143050 7:37121282-37121304 TTTGACAAGTTCAGAGAAGAAGG + Intronic
1023147644 7:37168320-37168342 TTTGACAAGTTCAGAGAAGAAGG - Intronic
1023166460 7:37348128-37348150 AATGAGATGTTCATTGAGGAGGG - Intronic
1023641947 7:42268176-42268198 ATTCAGCAGTCCAGTGAGAATGG - Intergenic
1023926645 7:44674502-44674524 ATTGACAAGTCTAGTGAGAATGG + Exonic
1025713882 7:63935652-63935674 TTTGAGAAATTCAGAAAGGAAGG - Intergenic
1025874613 7:65469473-65469495 ATTGACAAGTTGAGAGAAGAAGG - Intergenic
1025988064 7:66473520-66473542 ATAGAGAATTTCATGGAGGATGG + Intergenic
1027211049 7:76149417-76149439 ATAGAGAATTTCATGGAGGATGG + Intergenic
1028366992 7:90043827-90043849 ATTATAAAGTTTAGTGAGGAAGG + Intergenic
1028384716 7:90242142-90242164 ATGAAGAATTTCACTGAGGAGGG + Intergenic
1030163234 7:106529332-106529354 AATGAGAAGTTCTGAGAGGCGGG + Intergenic
1030411989 7:109192424-109192446 ATTTAGCAATTCAGTGAGGCAGG + Intergenic
1031053855 7:116972795-116972817 AGTGAGAAGTTGAGGGAGAAAGG - Intronic
1033620009 7:143053318-143053340 ATTGAGCAGTTCTGTGGGGAGGG + Exonic
1034087363 7:148332409-148332431 AATGAGCAGTTCAGAGAGAAAGG + Intronic
1035398991 7:158552368-158552390 CCTGAGAAGATCAGTGAGAAAGG + Intronic
1035762794 8:2081628-2081650 ATTGAGAAGAGCACTGGGGAAGG + Intronic
1035900882 8:3457217-3457239 GATGAGAGGTGCAGTGAGGAGGG - Intronic
1036139365 8:6192224-6192246 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
1036180882 8:6584218-6584240 ATTTAGCAGCTCAGGGAGGAAGG + Intronic
1037122902 8:15310578-15310600 ATAGAGAAGGTCAGGGAGCACGG - Intergenic
1037573092 8:20175211-20175233 ATGGAGATGTTCAGGGAGCAAGG - Intronic
1038069274 8:23995440-23995462 ATTGAGAAGTGCAGTGGGGAAGG + Intergenic
1038655833 8:29450346-29450368 TTTGACAAGTTCAGAGAAGAAGG + Intergenic
1038720149 8:30027918-30027940 TTTGAGAAGATCAGTGAGCTGGG + Intergenic
1038963960 8:32550622-32550644 CTTGACAAGTTCAGTGGGGGAGG + Intronic
1039112576 8:34055923-34055945 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
1039337356 8:36606479-36606501 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1041100130 8:54388108-54388130 ATTAAGAATCTTAGTGAGGAAGG - Intergenic
1042051227 8:64710210-64710232 ATTGAGAGTTTCAGAGAGGATGG - Intronic
1044068297 8:87724351-87724373 ATTGATAGCTTCAGTGGGGAAGG + Intergenic
1044960660 8:97528025-97528047 TTTGACAAGTTGAGAGAGGAAGG - Intergenic
1045336899 8:101213260-101213282 TTCAATAAGTTCAGTGAGGAAGG - Intergenic
1046530517 8:115439095-115439117 AGTGAGAAGTGCAGTGGGGCTGG + Intronic
1046635354 8:116669425-116669447 ACTGAGAAGAGCAGTGGGGATGG + Intronic
1047011949 8:120682486-120682508 AAGGAGAAGTTCAGAGAGGTTGG - Intronic
1047845675 8:128802368-128802390 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
1048743704 8:137590244-137590266 ATTCAGAAGTTCTGTGAGTGAGG - Intergenic
1050036431 9:1440567-1440589 AGGGTGAAGTTCAGTGAGGATGG - Intergenic
1050067615 9:1777131-1777153 ATTAAGAAATGCAGTGAGAAGGG - Intergenic
1050969051 9:11845812-11845834 AATGAGATATTCAGTGAAGAGGG + Intergenic
1051142797 9:13995916-13995938 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
1052481165 9:29028325-29028347 ATTGTGCAGTTCAGGAAGGAGGG + Intergenic
1052640389 9:31159932-31159954 TTTGACAAGTTGAGAGAGGAAGG - Intergenic
1055039448 9:71853279-71853301 ATTGTTAAGCTTAGTGAGGAAGG - Intergenic
1055918067 9:81427299-81427321 TTTGAGAGGTGCAGTGAGGTGGG - Intergenic
1057875197 9:98748221-98748243 ATTGGGAAGGTCAGTGCAGATGG - Intronic
1059547019 9:115186995-115187017 ATTAAGAAGTACAGTGGGGGAGG - Intronic
1060640279 9:125232412-125232434 ATTGGGTAGTCCAGGGAGGAAGG - Intronic
1062275356 9:135727836-135727858 ATTGGGACGGTCAGTCAGGATGG - Intronic
1186387155 X:9121491-9121513 ATTCTGGAGTTCAGTGAGCAGGG - Intronic
1187011696 X:15286316-15286338 TTTGAAACATTCAGTGAGGAGGG - Intronic
1188354724 X:29176785-29176807 ATTGAGGATTTTAGTGGGGAAGG - Intronic
1188469788 X:30525392-30525414 TTTGAGATGTTCAGTGAGGTAGG + Intergenic
1192043482 X:67647260-67647282 ATTGTAAACATCAGTGAGGATGG - Intronic
1192472226 X:71409033-71409055 AGAGAGACGTTCAGTGTGGATGG + Intronic
1192797679 X:74437679-74437701 TTTGAGATATTCTGTGAGGAAGG - Intronic
1192954202 X:76051779-76051801 TTTGACGAGTTCAGAGAGGAAGG - Intergenic
1193023114 X:76814039-76814061 ATTTAGAAGTTGAGTGGAGAAGG - Intergenic
1195677158 X:107515399-107515421 ATTGAGAAGTTGAGTAGGTAAGG + Intergenic
1196146829 X:112327163-112327185 TTTGACGAGCTCAGTGAGGAAGG + Intergenic
1197856286 X:130917069-130917091 ATTGGGCAGTTCAGTTTGGAAGG + Intergenic
1198621337 X:138514068-138514090 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1199884700 X:152007912-152007934 TTTGACAAGTTGAGAGAGGAAGG + Intergenic
1200013786 X:153142754-153142776 ATTATTAAGCTCAGTGAGGAGGG + Intergenic
1200025815 X:153257201-153257223 ATTATTAAGCTCAGTGAGGAGGG - Intergenic
1201948684 Y:19540017-19540039 ATTAAAAAGTTGAGTGAGGCCGG + Intergenic