ID: 1125328002

View in Genome Browser
Species Human (GRCh38)
Location 15:38556197-38556219
Sequence TGATCTCTGGTTAGAACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125328002 Original CRISPR TGATCTCTGGTTAGAACAGA AGG Intronic
900271114 1:1789385-1789407 TGTGCTCTGGTAAGAACAGAGGG + Intronic
911417666 1:97596282-97596304 TGATCTCTGTTTAGATTACATGG - Intronic
912489446 1:110053849-110053871 TGACCTCTGGTTAGAAAGGGAGG + Exonic
913563995 1:120052868-120052890 TGAACTCTGGTAAGAATGGAGGG - Intronic
913634130 1:120740697-120740719 TGAACTCTGGTAAGAATGGAGGG + Intergenic
913690389 1:121274328-121274350 TGACCTCTCCTGAGAACAGAAGG + Intronic
914147152 1:145005631-145005653 TGACCTCTCCTGAGAACAGAAGG - Intronic
914284584 1:146212216-146212238 TGAACTCTGGTAAGAATGGAGGG - Intronic
914545615 1:148662955-148662977 TGAACTCTGGTAAGAATGGAGGG - Intronic
914620948 1:149407711-149407733 TGAACTCTGGTAAGAATGGAGGG + Intergenic
916574566 1:166055976-166055998 TGATCTCTGGAAAGAACAATTGG - Intergenic
919072592 1:192774608-192774630 TGAGCAATGGTTAGAGCAGAAGG - Intergenic
919503461 1:198368000-198368022 GGAAGTCTGGTTAGAACAGTGGG - Intergenic
920477707 1:206292816-206292838 TGACCTCTCCTGAGAACAGAAGG + Intronic
921115607 1:212087985-212088007 AGATCTCTGGCTAAAACATAGGG - Intronic
924217334 1:241837319-241837341 TGATTTCTGGATATAACAGTAGG + Intergenic
1063472226 10:6297327-6297349 TGTTCCCTGGTTAGGACACAGGG + Intergenic
1072380597 10:94865582-94865604 TGATTTCTGATTTGAAAAGAAGG + Intergenic
1073640335 10:105246067-105246089 TGATCTCTATTCACAACAGATGG + Intronic
1077782940 11:5351750-5351772 TGTTCTGTGGTTAGATCACAGGG + Exonic
1077972093 11:7205236-7205258 TGATCTCTGGGGAGGAGAGAGGG + Intergenic
1081217158 11:40415579-40415601 TGAGTTCTGGTTAGAACATAAGG - Intronic
1082231064 11:49767190-49767212 AGATATCTGTTTAGAACAGTGGG + Intergenic
1083545701 11:63547457-63547479 TGGACTCTGGGTAGAACAGCTGG - Intergenic
1083619443 11:64041754-64041776 TTCTCTCTGGTCAGACCAGAGGG + Intronic
1086703153 11:89922646-89922668 TATTCTCAGGTTAGAGCAGAAGG - Intergenic
1087264618 11:96046610-96046632 TGAACTCTGCTTACATCAGAAGG + Intronic
1088572073 11:111231967-111231989 TGAGCTCAGCTTAGAACAAAAGG - Intergenic
1088900978 11:114117085-114117107 AGATCACTGGTTAGACCAGAGGG + Intronic
1092306878 12:7310522-7310544 TGATCCCTGGGAAGGACAGAGGG - Exonic
1094687641 12:32734499-32734521 TCAACTCTGGTTAAAACAGATGG + Intronic
1095919862 12:47518264-47518286 TGATCTGTGATTACACCAGACGG - Intergenic
1098472731 12:70864386-70864408 TAATCTGTGGTCAGAAGAGAGGG + Intronic
1102298947 12:111757562-111757584 TCGTCTCAGGTTAGACCAGACGG + Intronic
1102805757 12:115778838-115778860 TGCTCTCTGTTTAGAAGAGTTGG - Intergenic
1105457333 13:20553731-20553753 AGATCACTGATTAAAACAGAAGG - Intergenic
1108177389 13:47807153-47807175 TACTCTCTGGTTTAAACAGAAGG + Intergenic
1109248845 13:59993149-59993171 TTATTTCTGGTTAAAACATAGGG - Intronic
1109534835 13:63701899-63701921 GGACCTCTGGTTAAAACAAAAGG + Intergenic
1109881518 13:68484292-68484314 TGATGTGTGGTTATATCAGAAGG + Intergenic
1111042731 13:82770880-82770902 TGCTATCTTGTTAGAGCAGAAGG - Intergenic
1112561917 13:100522707-100522729 TGAGGTCTGTTTGGAACAGACGG - Intronic
1115734598 14:36311003-36311025 TGATCTCTGGCTTGGACTGATGG - Intronic
1117518453 14:56526096-56526118 TGTTCTCGGGTTGAAACAGATGG - Intronic
1122393694 14:101407845-101407867 TGGCCTCTGGGTGGAACAGAGGG + Intergenic
1124600804 15:31131667-31131689 TGATCACTGGTTAGACTGGAGGG + Intronic
1125328002 15:38556197-38556219 TGATCTCTGGTTAGAACAGAAGG + Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128957759 15:71966571-71966593 TGACCTCTGGCTAGAGCTGATGG - Intronic
1134404368 16:13942902-13942924 TGCACTCTGGTTAGGACAAAGGG - Intronic
1137629435 16:49931801-49931823 TGATCTCAGGTTAGGACACTTGG - Intergenic
1140944699 16:79757089-79757111 TGATCTCTTGGTAGGAGAGATGG + Intergenic
1141341174 16:83205091-83205113 TGATCTGTGAATAGAAGAGATGG + Intronic
1143479276 17:7219304-7219326 TGGTCTCTGGAAGGAACAGAGGG + Exonic
1144728219 17:17512334-17512356 TTGTCTGTGGTTAGAACAGGAGG - Intronic
1147328930 17:39684976-39684998 TGATCTCTGGGAAGACCAGATGG + Intronic
1153053941 18:927179-927201 TGAGCTATGTTTAGAATAGAAGG + Intergenic
1154259865 18:12821450-12821472 TGACATCTGGTTAGGACATAGGG - Intronic
1156058077 18:33035188-33035210 TGACCTCTGGTTTGACAAGAGGG + Intronic
1156114067 18:33765722-33765744 TGATCTTTAGCTAGAACATAAGG - Intergenic
1156121175 18:33844922-33844944 TGTTCTCTGGCAAGAAAAGAAGG + Intergenic
1156561539 18:38131025-38131047 GGATCTCTGGATAGTACTGAAGG + Intergenic
1162051349 19:8035720-8035742 TGATCTGTGGTAAGTAAAGAAGG - Intronic
1164577615 19:29414876-29414898 TGATCTGTGGTCAGAACCCATGG - Intergenic
1202646813 1_KI270706v1_random:149562-149584 TTATATCATGTTAGAACAGAAGG + Intergenic
925940268 2:8810265-8810287 TGATCTCTGTTTAGAGAAGCAGG - Intronic
926223200 2:10949576-10949598 TGATCTCTGCTTCTAATAGAAGG - Intergenic
930376678 2:50575883-50575905 TGATTTCTGGTTACGAGAGAGGG - Intronic
930479993 2:51935894-51935916 TTGACTCTGGCTAGAACAGATGG + Intergenic
932452163 2:71818304-71818326 TGTTCTCTGGTAGGAAGAGACGG + Intergenic
933553551 2:83805128-83805150 GCATCTCTGAATAGAACAGAAGG + Intergenic
934158146 2:89222369-89222391 GGGTCTCTGGTAAGAAAAGAAGG - Intergenic
934209117 2:89960055-89960077 GGGTCTCTGGTAAGAAAAGAAGG + Intergenic
937539215 2:122927550-122927572 TTCTGTCTGGTTAGAGCAGAGGG - Intergenic
941579623 2:167278651-167278673 TGATTTGTAGTTAGAACACATGG - Intergenic
941613896 2:167696806-167696828 TCATCTCTTGATAGAAGAGATGG - Intergenic
942494454 2:176525122-176525144 GGATTTCTGGTTAGACTAGAGGG + Intergenic
943757789 2:191575000-191575022 AAATCTCTGGTCAGGACAGATGG + Intergenic
1169696493 20:8393200-8393222 TGATTTCAGGTAAGAACAGAGGG + Intronic
1170113592 20:12832210-12832232 TGATCTGTGATTGGAACAGATGG - Intergenic
1170358256 20:15516586-15516608 TGCGTTCTGGTTTGAACAGAAGG + Intronic
1171169225 20:23000738-23000760 TGGTCTGTGGATGGAACAGAAGG - Intergenic
1171722879 20:28582581-28582603 TGTTCTCTGGCTAGGACACAGGG - Intergenic
1173081919 20:39876505-39876527 TCATCTTTGGGTAGAACAAAGGG - Intergenic
1175229962 20:57467513-57467535 TGATCTCTGCTTTGCAGAGATGG + Intergenic
1176605051 21:8823212-8823234 TTATATCATGTTAGAACAGAAGG - Intergenic
1179025806 21:37677328-37677350 TGATCTCTGGATGGAACACAGGG - Intronic
1180122259 21:45761701-45761723 TGGTCTCTGGTGAGGACAGTAGG + Intronic
1180347343 22:11714817-11714839 TTATATCATGTTAGAACAGAAGG - Intergenic
1180355102 22:11832922-11832944 TTATATCATGTTAGAACAGAAGG - Intergenic
1180383149 22:12159409-12159431 TTATATCATGTTAGAACAGAAGG + Intergenic
1180691861 22:17723384-17723406 TTATCTCTGCTTAGAAGAGATGG + Intronic
1181490068 22:23256103-23256125 TGATCTTTGGTTTGAAGACATGG + Intronic
949497171 3:4643313-4643335 TTATTTTTGGTTAGAAAAGATGG - Intronic
957306969 3:78469790-78469812 TTATCTTTGGTAAAAACAGAGGG + Intergenic
957555477 3:81761112-81761134 AGACCGCTGATTAGAACAGAGGG + Intronic
960434719 3:117611736-117611758 TGACCTCTGGTTAGAAAATAGGG - Intergenic
960575688 3:119227333-119227355 TGAACTCTGGTAAGAGCAAAGGG + Intronic
962306154 3:134288211-134288233 TGTTTTCTGGATAGAAAAGATGG - Intergenic
962778416 3:138686890-138686912 TGATCTGTGGTTTTAACAGATGG - Intronic
963010530 3:140765950-140765972 TGATTTCTTGTTAGCACTGAAGG + Intergenic
966308846 3:178570807-178570829 TGAACTCTGGTAAGAAGAAAAGG + Intronic
967649362 3:191966672-191966694 TGATATCTGGTTCAACCAGAAGG + Intergenic
969845786 4:9919034-9919056 TGAATTCTGTTTAGAACTGATGG + Intronic
971728968 4:30351471-30351493 TGATCACTGATTAGCTCAGATGG + Intergenic
972780433 4:42282640-42282662 TCAGCTTTGGTTAGATCAGATGG + Intergenic
973387936 4:49527355-49527377 TTATATCATGTTAGAACAGAAGG - Intergenic
973889801 4:55357496-55357518 TGATCTTTGGTTATACCACAGGG - Intronic
975900690 4:79148485-79148507 TGTTATCTGGTAAGAACAGATGG - Intergenic
981018366 4:139999428-139999450 TGAACTTTTGTTAGAACAGTGGG - Intronic
981827217 4:148957030-148957052 TGATCTCTGGATAGCAGTGATGG - Intergenic
986525316 5:8667826-8667848 TGGTATCTGGTTAAAAAAGAAGG - Intergenic
987294769 5:16540035-16540057 TGCTTTCTGGTTAGGACAAAGGG + Intronic
988573265 5:32393133-32393155 TAATGTCTGGTTTTAACAGAAGG - Intronic
988604148 5:32665949-32665971 TTGTCTCTGGTTAGAAAAGGAGG + Intergenic
990225260 5:53644292-53644314 TGAGCTCAGCTCAGAACAGAGGG + Intronic
991605518 5:68396786-68396808 TTCTCTCTGGGAAGAACAGAGGG - Intergenic
992564237 5:77982055-77982077 TGATCTTGGGTTAGACCAGTGGG - Intergenic
992740747 5:79771039-79771061 TGAACTCTGGCCAAAACAGAGGG + Intronic
992920933 5:81519495-81519517 TGATTTTTGGTGAGAACACAGGG - Intronic
993086234 5:83366984-83367006 TAAAATCTGGTGAGAACAGATGG - Intergenic
993234742 5:85289941-85289963 TGATCTCTGGTGAGATAGGAAGG - Intergenic
997354242 5:133252260-133252282 TGATCTGTGGTCAGACTAGAAGG + Intronic
998539103 5:142962729-142962751 TGAACTGTGGGTAGAACAGAGGG + Intronic
998695952 5:144639765-144639787 TGATCTCTGATTCAAAAAGATGG + Intergenic
999618093 5:153446430-153446452 TGATATTTACTTAGAACAGATGG + Intergenic
999790240 5:154932863-154932885 TTATCTCTAGTTAGAAGAGTTGG - Intronic
1000293135 5:159889870-159889892 AGATCTCTGGTTATAAAACAAGG - Intergenic
1001105179 5:168847316-168847338 TTATCTGTGGTTAGAACAAAAGG - Intronic
1001395122 5:171413360-171413382 TGTTCTCTGGTTGAAACTGAGGG - Intergenic
1005110571 6:22277009-22277031 TGTTCTCTGACTATAACAGAAGG - Intergenic
1013707225 6:112851375-112851397 TTATCTCTGACTAGAACAAATGG - Intergenic
1013753444 6:113433924-113433946 TGAATTCTGTTTATAACAGAAGG - Intergenic
1014362603 6:120498821-120498843 TGAACTTTGGTAAGAACAGTGGG + Intergenic
1014794439 6:125707992-125708014 TAATCACTGCTTAAAACAGAGGG - Intergenic
1014809903 6:125873404-125873426 TGATGTATGTTTAAAACAGATGG + Intronic
1014918119 6:127178812-127178834 TGATTTCTGGTTAGCTCAGAAGG + Intronic
1015158868 6:130128890-130128912 TGCTCTCTGGATAGATCGGATGG - Intronic
1016499119 6:144699073-144699095 TGCTTTTTGGTTACAACAGAAGG + Intronic
1017075159 6:150611086-150611108 TGCTCTCTAGTGGGAACAGAAGG - Intronic
1018066632 6:160129118-160129140 TGGACTCTGGGGAGAACAGAGGG - Intronic
1024841919 7:53596509-53596531 TGATCTCAGGTTAGGGCTGAGGG + Intergenic
1026432010 7:70357054-70357076 AGTTCACTGGGTAGAACAGAGGG + Intronic
1030347641 7:108452837-108452859 TGATCTATGGTGAGAATATAAGG + Intronic
1034395753 7:150823910-150823932 TGGTCTCAGGTTACAACAGTTGG - Intergenic
1035796239 8:2359700-2359722 TGAGCTCAGCTTAGAAGAGACGG + Intergenic
1038029867 8:23628508-23628530 TAAACTCTGGTTAGACCACAAGG + Intergenic
1038137645 8:24805686-24805708 TGATCTATGATAAGTACAGAAGG - Intergenic
1038241456 8:25811635-25811657 TGCTTTCTGGCTTGAACAGATGG + Intergenic
1038475864 8:27867714-27867736 TGTTTTCTGGTTATGACAGAAGG - Intergenic
1038912096 8:31976402-31976424 TGAACTCTTGTCAGAACATATGG - Intronic
1043316704 8:78931802-78931824 TGATCTTTTGTTGGAAGAGATGG + Intergenic
1044124386 8:88438890-88438912 TGATCTCCGGTAAGATCAGAGGG - Intergenic
1046248716 8:111601676-111601698 TGATCTCTGGTTACTCCAAAAGG - Intergenic
1047027399 8:120839082-120839104 TGATTTCTGGTCAGAAGAGTGGG - Intergenic
1047119303 8:121882695-121882717 TGATCACTGATCAAAACAGAAGG + Intergenic
1049911526 9:273117-273139 TGATTTCTGGTTATTTCAGAAGG + Intronic
1051565810 9:18496869-18496891 GGACCTCTGGTTAGATTAGATGG + Intronic
1053479575 9:38406036-38406058 TGCTTTGTGGTTAGAGCAGAGGG - Intergenic
1055042809 9:71893660-71893682 TAATCTCTGGGTAGGAGAGAGGG - Intronic
1055902736 9:81259745-81259767 TGATCTCTGATTAGCACATTGGG + Intergenic
1203696775 Un_GL000214v1:105731-105753 TTATATCATGTTAGAACAGAAGG + Intergenic
1187947368 X:24439557-24439579 TCATCTCAGGTTAGTACAGGGGG + Intergenic
1188488762 X:30713439-30713461 TCCTCTGTGGTTAGAACAAAGGG + Intronic
1189192721 X:39124473-39124495 TGATCTCAGGTTAAAAAGGAGGG - Intergenic
1191191804 X:57675831-57675853 TGACATCTGGTAACAACAGAGGG - Intergenic
1192209213 X:69116791-69116813 TGGTCTCTGGAGAGAACAGCGGG - Intergenic
1193646251 X:84072086-84072108 TCTTGTCTGGTTAGAACAGTTGG - Intronic
1194123890 X:89990895-89990917 TTATCTCTGGTTAGGAAAGCAGG + Intergenic
1196026993 X:111051641-111051663 TGATCTCTCCTTAGTACAGTGGG + Intronic
1197151385 X:123223678-123223700 TCATCTGTGGTTAGATGAGAAGG + Intronic
1198235620 X:134733762-134733784 TGAGGCCTGGTTTGAACAGAAGG + Intronic
1198442801 X:136680699-136680721 TAATCTCTGGACAGAACACATGG + Intronic
1199582793 X:149377087-149377109 GTGTCTCTGGTTATAACAGATGG + Intergenic
1199791586 X:151160540-151160562 TGATACCTGATTAGAACAGCTGG + Intergenic
1200476778 Y:3648517-3648539 TTATCTCTGGTTAGGAAAGCAGG + Intergenic
1201153712 Y:11110875-11110897 TTATATCATGTTAGAACAGAAGG - Intergenic