ID: 1125333879

View in Genome Browser
Species Human (GRCh38)
Location 15:38608376-38608398
Sequence GCCTCTGTGTGAGGTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125333879_1125333886 -8 Left 1125333879 15:38608376-38608398 CCAGAAACACCTCACACAGAGGC No data
Right 1125333886 15:38608391-38608413 ACAGAGGCATCATGGGGCAGGGG No data
1125333879_1125333890 18 Left 1125333879 15:38608376-38608398 CCAGAAACACCTCACACAGAGGC No data
Right 1125333890 15:38608417-38608439 GACACACGGGTCAGAAGACCTGG No data
1125333879_1125333891 19 Left 1125333879 15:38608376-38608398 CCAGAAACACCTCACACAGAGGC No data
Right 1125333891 15:38608418-38608440 ACACACGGGTCAGAAGACCTGGG No data
1125333879_1125333885 -9 Left 1125333879 15:38608376-38608398 CCAGAAACACCTCACACAGAGGC No data
Right 1125333885 15:38608390-38608412 CACAGAGGCATCATGGGGCAGGG No data
1125333879_1125333884 -10 Left 1125333879 15:38608376-38608398 CCAGAAACACCTCACACAGAGGC No data
Right 1125333884 15:38608389-38608411 ACACAGAGGCATCATGGGGCAGG No data
1125333879_1125333889 5 Left 1125333879 15:38608376-38608398 CCAGAAACACCTCACACAGAGGC No data
Right 1125333889 15:38608404-38608426 GGGGCAGGGGAAGGACACACGGG No data
1125333879_1125333888 4 Left 1125333879 15:38608376-38608398 CCAGAAACACCTCACACAGAGGC No data
Right 1125333888 15:38608403-38608425 TGGGGCAGGGGAAGGACACACGG No data
1125333879_1125333887 -4 Left 1125333879 15:38608376-38608398 CCAGAAACACCTCACACAGAGGC No data
Right 1125333887 15:38608395-38608417 AGGCATCATGGGGCAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125333879 Original CRISPR GCCTCTGTGTGAGGTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr