ID: 1125336397

View in Genome Browser
Species Human (GRCh38)
Location 15:38630691-38630713
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125336397_1125336401 15 Left 1125336397 15:38630691-38630713 CCAAGGGCCAACAGTGCAGCTTT No data
Right 1125336401 15:38630729-38630751 TTGCCTTTGCAGAGCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125336397 Original CRISPR AAAGCTGCACTGTTGGCCCT TGG (reversed) Intergenic
No off target data available for this crispr