ID: 1125337577

View in Genome Browser
Species Human (GRCh38)
Location 15:38642296-38642318
Sequence TAACTCTCCTTTGCCAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125337577_1125337581 15 Left 1125337577 15:38642296-38642318 CCTCTATTGGCAAAGGAGAGTTA No data
Right 1125337581 15:38642334-38642356 TTGAATCTACCAGCTTCATTAGG No data
1125337577_1125337579 -10 Left 1125337577 15:38642296-38642318 CCTCTATTGGCAAAGGAGAGTTA No data
Right 1125337579 15:38642309-38642331 AGGAGAGTTAAGAGAGTTAAGGG No data
1125337577_1125337580 -9 Left 1125337577 15:38642296-38642318 CCTCTATTGGCAAAGGAGAGTTA No data
Right 1125337580 15:38642310-38642332 GGAGAGTTAAGAGAGTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125337577 Original CRISPR TAACTCTCCTTTGCCAATAG AGG (reversed) Intergenic
No off target data available for this crispr