ID: 1125342131

View in Genome Browser
Species Human (GRCh38)
Location 15:38685629-38685651
Sequence AAGCTGATTAATAGGAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125342131_1125342135 15 Left 1125342131 15:38685629-38685651 CCTTGTCTCCTATTAATCAGCTT No data
Right 1125342135 15:38685667-38685689 AGCGAAACATCAGAAGGTGATGG No data
1125342131_1125342136 16 Left 1125342131 15:38685629-38685651 CCTTGTCTCCTATTAATCAGCTT No data
Right 1125342136 15:38685668-38685690 GCGAAACATCAGAAGGTGATGGG No data
1125342131_1125342137 17 Left 1125342131 15:38685629-38685651 CCTTGTCTCCTATTAATCAGCTT No data
Right 1125342137 15:38685669-38685691 CGAAACATCAGAAGGTGATGGGG No data
1125342131_1125342133 9 Left 1125342131 15:38685629-38685651 CCTTGTCTCCTATTAATCAGCTT No data
Right 1125342133 15:38685661-38685683 ATTTCCAGCGAAACATCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125342131 Original CRISPR AAGCTGATTAATAGGAGACA AGG (reversed) Intergenic
No off target data available for this crispr