ID: 1125343253

View in Genome Browser
Species Human (GRCh38)
Location 15:38695089-38695111
Sequence GCAGAATTGGGGGGCGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125343243_1125343253 22 Left 1125343243 15:38695044-38695066 CCAAAACTTGGGTGGTTGAGATG No data
Right 1125343253 15:38695089-38695111 GCAGAATTGGGGGGCGGGTGCGG No data
1125343242_1125343253 23 Left 1125343242 15:38695043-38695065 CCCAAAACTTGGGTGGTTGAGAT No data
Right 1125343253 15:38695089-38695111 GCAGAATTGGGGGGCGGGTGCGG No data
1125343239_1125343253 30 Left 1125343239 15:38695036-38695058 CCCGTTTCCCAAAACTTGGGTGG No data
Right 1125343253 15:38695089-38695111 GCAGAATTGGGGGGCGGGTGCGG No data
1125343241_1125343253 29 Left 1125343241 15:38695037-38695059 CCGTTTCCCAAAACTTGGGTGGT No data
Right 1125343253 15:38695089-38695111 GCAGAATTGGGGGGCGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125343253 Original CRISPR GCAGAATTGGGGGGCGGGTG CGG Intergenic
No off target data available for this crispr