ID: 1125346090

View in Genome Browser
Species Human (GRCh38)
Location 15:38720567-38720589
Sequence CTGAATGAAGTGCTTAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125346088_1125346090 13 Left 1125346088 15:38720531-38720553 CCTTTGGGAATGACATTTTGTGT No data
Right 1125346090 15:38720567-38720589 CTGAATGAAGTGCTTAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125346090 Original CRISPR CTGAATGAAGTGCTTAAAAT AGG Intergenic
No off target data available for this crispr