ID: 1125353280

View in Genome Browser
Species Human (GRCh38)
Location 15:38789980-38790002
Sequence CCAACCTACTAGGGTATTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125353270_1125353280 18 Left 1125353270 15:38789939-38789961 CCAATGCTGAGCCTTTGATACAG No data
Right 1125353280 15:38789980-38790002 CCAACCTACTAGGGTATTATTGG No data
1125353272_1125353280 7 Left 1125353272 15:38789950-38789972 CCTTTGATACAGGATTGTTCTCT No data
Right 1125353280 15:38789980-38790002 CCAACCTACTAGGGTATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125353280 Original CRISPR CCAACCTACTAGGGTATTAT TGG Intergenic
No off target data available for this crispr