ID: 1125356564

View in Genome Browser
Species Human (GRCh38)
Location 15:38822715-38822737
Sequence GTTGGAATGAAACCAAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125356564_1125356570 22 Left 1125356564 15:38822715-38822737 CCTTATTTTGGTTTCATTCCAAC No data
Right 1125356570 15:38822760-38822782 CTCATGCATAATAAACCAGATGG No data
1125356564_1125356566 -4 Left 1125356564 15:38822715-38822737 CCTTATTTTGGTTTCATTCCAAC No data
Right 1125356566 15:38822734-38822756 CAACTTGCCCAAGTGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125356564 Original CRISPR GTTGGAATGAAACCAAAATA AGG (reversed) Intergenic
No off target data available for this crispr