ID: 1125359985

View in Genome Browser
Species Human (GRCh38)
Location 15:38854799-38854821
Sequence GAGTCATGTCATTAACTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125359978_1125359985 20 Left 1125359978 15:38854756-38854778 CCGGCACCTTTCTATTGAGCCCA No data
Right 1125359985 15:38854799-38854821 GAGTCATGTCATTAACTGCTAGG No data
1125359979_1125359985 14 Left 1125359979 15:38854762-38854784 CCTTTCTATTGAGCCCAGATGTG No data
Right 1125359985 15:38854799-38854821 GAGTCATGTCATTAACTGCTAGG No data
1125359981_1125359985 1 Left 1125359981 15:38854775-38854797 CCCAGATGTGTTTCCATGGCAAA No data
Right 1125359985 15:38854799-38854821 GAGTCATGTCATTAACTGCTAGG No data
1125359982_1125359985 0 Left 1125359982 15:38854776-38854798 CCAGATGTGTTTCCATGGCAAAG No data
Right 1125359985 15:38854799-38854821 GAGTCATGTCATTAACTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125359985 Original CRISPR GAGTCATGTCATTAACTGCT AGG Intergenic
No off target data available for this crispr